View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7439_low_23 (Length: 240)
Name: NF7439_low_23
Description: NF7439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7439_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 374462 - 374237
Alignment:
| Q |
1 |
ataaggtgtagtagatatagactatatagattttcagttgacacctactggaaaaatgatcaacacttgtgtcccatgatattaatttcaccattcaaca |
100 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374462 |
ataaggtgtggtagatatggactatatagattttcagttgacacctactggaaaaatgatcaacacttgtgtcccatgatattaatttcaccattcaaca |
374363 |
T |
|
| Q |
101 |
cttgtttgtggatggtagacagtaacaattttgtgttgacacatatttagataagatattttcttactgtttacagcaaaagtgaatgccttcatcacta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
374362 |
cttgtttgtggatggtagacagtaacaattttgtgttgacacatatttagataagatattttcttactgtttacagcaaaagtgaatgccttcatcacta |
374263 |
T |
|
| Q |
201 |
atgatggctctagaggtatcaaacct |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
374262 |
atgatggctctagaggtatcaaacct |
374237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University