View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7440_high_2 (Length: 242)
Name: NF7440_high_2
Description: NF7440
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7440_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 78 - 223
Target Start/End: Complemental strand, 13385233 - 13385088
Alignment:
| Q |
78 |
cgtaacaccgccgttaccgtttcgattaatcattccatttctttgttattagtgttgttcttcttcttttgcttttagggtttcattccctggtattgtt |
177 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13385233 |
cgtaacaccaccgttaccgtttcgataaatcatttcatttctttgttattagtgttgttgttcttcttttgcttttagggtttcattccctagtattgtt |
13385134 |
T |
 |
| Q |
178 |
cttcgacctgttgggaatttcaggagcaattatgattatcattacc |
223 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13385133 |
cttcgacatgttgggaatttcaggagcagttatgattatcattacc |
13385088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 78 - 207
Target Start/End: Original strand, 35712961 - 35713090
Alignment:
| Q |
78 |
cgtaacaccgccgttaccgtttcgattaatcattccatttctttgttattagtgttgttcttcttcttttgcttttagggtttcattccctggtattgtt |
177 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35712961 |
cgtaacaccgccgttaccgtttcgatcaatcctttcatttctttgttattagtgttgttgttcttcttttgcttttagggtttcattccctggtattgtt |
35713060 |
T |
 |
| Q |
178 |
cttcgacctgttgggaatttcaggagcaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
35713061 |
cttcgacctgttgggaatttcaggagcaat |
35713090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 162 - 223
Target Start/End: Complemental strand, 817134 - 817073
Alignment:
| Q |
162 |
attccctggtattgttcttcgacctgttgggaatttcaggagcaattatgattatcattacc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
817134 |
attccctggtattgttcttcgacctgttgggaatttcaagagcaattatgattatcattacc |
817073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 78 - 163
Target Start/End: Original strand, 23485545 - 23485628
Alignment:
| Q |
78 |
cgtaacaccgccgttaccgtttcgattaatcattccatttctttgttattagtgtt---gttcttcttcttttgcttttagggtttcat |
163 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| |||||||| |||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
23485545 |
cgtaacaccgccgttactgtttc----aatcatttcatttctt-gttagtagtgttgttgttcttcttcttttgcttttagggtttcat |
23485628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University