View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7441_high_14 (Length: 219)
Name: NF7441_high_14
Description: NF7441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7441_high_14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 31097413 - 31097631
Alignment:
| Q |
1 |
ccacacaatcaactgatcatgattagtcttgtgtaggtaattgttgatcggttgaattcttgctacctttgatcagtatatagaactctaaagggataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097413 |
ccacacaatcaactgatcatgattagtcttgtgtaggtaattgttgatcggttgaattcttgctacctttgatcagtatatagaactctaaagggataaa |
31097512 |
T |
 |
| Q |
101 |
gattgagaataagtnnnnnnnnctttatcaatttaaaaatatcaaactgattgttaattaaatcttgatataaaaactgacttgataaaaatatcattac |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31097513 |
gattgagaataagtaaaaaaaactttatcaatttaaaaatatcaaactgattgttaattaaatcttgatataaaaactgacttgataaaaatatcattac |
31097612 |
T |
 |
| Q |
201 |
tattagaccagccacctca |
219 |
Q |
| |
|
||||| ||||||||||||| |
|
|
| T |
31097613 |
tattaaaccagccacctca |
31097631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University