View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7441_high_8 (Length: 274)
Name: NF7441_high_8
Description: NF7441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7441_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 15625455 - 15625279
Alignment:
| Q |
1 |
ccttattatgttttgcattttcttgactattggtggtaggtacttagcttgagaagcgaagagaaactccaaacttatgttcttgacttttcataggact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15625455 |
ccttattatgttttgcattttcttgactattggtggtaggtatttagcttgagaagcaaagagaaactccaaacttatgttcttgacttttcgtaggact |
15625356 |
T |
 |
| Q |
101 |
gggtatgcttcaatccctctactatttgttaaatcttcatggtgtcggggagggtgtacgcatttgttatcccgtgt |
177 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15625355 |
gggtatgcttcactccctctactatttgttaaatcttcatggtgtcggggagggtgtacgcatttgttatcccgtgt |
15625279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 190 - 266
Target Start/End: Complemental strand, 15623569 - 15623493
Alignment:
| Q |
190 |
accataatttcatcaaatatacgacaacaaaaatcaacatctattaacacgcactcgtagtgaccaaagatattatt |
266 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |||| ||| ||| | |||||||||||||| ||||| |
|
|
| T |
15623569 |
accataatttcatcaaatatacgacaagaaaaatcaacatccattagcactcacgcatagtgaccaaagattttatt |
15623493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University