View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7441_low_10 (Length: 245)
Name: NF7441_low_10
Description: NF7441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7441_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 40464149 - 40464099
Alignment:
| Q |
18 |
atatatgtgttggtaaattttgatggtctattatagactaaaaatataacc |
68 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40464149 |
atatatgttttggtaaattttgatggtctattatagactaaaaatataacc |
40464099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University