View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7442_low_1 (Length: 588)
Name: NF7442_low_1
Description: NF7442
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7442_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 2e-63
Query Start/End: Original strand, 354 - 565
Target Start/End: Original strand, 51811078 - 51811279
Alignment:
| Q |
354 |
gatgaaattattgcgaaagttacaagaaatcatttagaggagcnnnnnnnnagtggcaggctttggaaataaagtctaccataaattgtgactatattat |
453 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||| ||||||||||||| ||| |
|
|
| T |
51811078 |
gatgaagttattgcgaaagttacaagaaatcatttagtggagcttttttttagtggcaggctttggaaatcaagtctaccagaaattgtgactat--tat |
51811175 |
T |
|
| Q |
454 |
tagttgaaattgtcgacgaccctgtaacggtgtaacctaagtgcagttcttacgttgaaatacctgatttggttctaaatactaattgcattgtcttttg |
553 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51811176 |
tagttgaaattgtcgacgactctgta--------acctaagtgcagttcttacgttgaaatacctgatttggttctaaagactaattgcattgtcttttg |
51811267 |
T |
|
| Q |
554 |
tttgagactatt |
565 |
Q |
| |
|
|||||||||||| |
|
|
| T |
51811268 |
tttgagactatt |
51811279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University