View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7443_high_4 (Length: 214)
Name: NF7443_high_4
Description: NF7443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7443_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 108 - 197
Target Start/End: Original strand, 36363871 - 36363960
Alignment:
| Q |
108 |
gatcatctacctcaatttttgttggtgattcttctgttccaccagctgcacatacacaatcactttaaaagtgttcctaatattgatatt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||||||| |
|
|
| T |
36363871 |
gatcatctacctcaatttttgttggtgattcttctgttccaccagctgcacatacacaatcacttttaaggtattcctaatattgatatt |
36363960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University