View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7443_low_7 (Length: 214)

Name: NF7443_low_7
Description: NF7443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7443_low_7
NF7443_low_7
[»] chr5 (1 HSPs)
chr5 (108-197)||(36363871-36363960)


Alignment Details
Target: chr5 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 108 - 197
Target Start/End: Original strand, 36363871 - 36363960
Alignment:
108 gatcatctacctcaatttttgttggtgattcttctgttccaccagctgcacatacacaatcactttaaaagtgttcctaatattgatatt 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||    
36363871 gatcatctacctcaatttttgttggtgattcttctgttccaccagctgcacatacacaatcacttttaaggtattcctaatattgatatt 36363960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University