View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7445_high_3 (Length: 220)
Name: NF7445_high_3
Description: NF7445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7445_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 51 - 210
Target Start/End: Original strand, 41218699 - 41218858
Alignment:
| Q |
51 |
acttctatctcatcctttgagaatgggcacaagtacaacacaatgaggtgaagtgaactagtgagtgaggtgggacaagttattaattaataagttacta |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41218699 |
acttctatctcatcctttgagaatgggcacaagtacaacacaatgaggtgaagtgaactagtgagtgaggtgggacaagttattaattaataagttacta |
41218798 |
T |
 |
| Q |
151 |
taaatatgcattnnnnnnntttaaagtatattcaatttcatggctatgcctttgctactc |
210 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
41218799 |
taaatatgcattaaaaaaatttaaagtatatgcaatttcatggctatgccttagctactc |
41218858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 41218643 - 41218677
Alignment:
| Q |
1 |
gtttatgtttatgtttcttgagctatctttctatc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
41218643 |
gtttatgtttatgtttcttgagctatctttctatc |
41218677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University