View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7445_low_2 (Length: 327)
Name: NF7445_low_2
Description: NF7445
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7445_low_2 |
 | |
|
| [»] scaffold0122 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 316
Target Start/End: Complemental strand, 1051876 - 1051567
Alignment:
| Q |
19 |
atgtggcggtggaagaggtcgttgtttgtatgggaagaagaagttttcactgaattggaagctacccgtggtgatgttggacagaacttagtaggaggta |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1051876 |
atgtggcggcggaagaggtcgttgtttgtatgggaagaag---ttttcaatgaattggaagctacccgtggtggtgttggacagaacttagtaggaggta |
1051780 |
T |
|
| Q |
119 |
gtgatggggtggatttggttgttagaaaaatgttgaggggttctcggttagttcttgttttaaacatttagttttgcttttatatgttcaatctagtgat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1051779 |
gtgatggggtggatttggttgttagaaaaatgttgaggggttctcggttagttcttgttttaaacatttggttttgcttttatatgttcaatctagtgat |
1051680 |
T |
|
| Q |
219 |
ctggttttcataaaaggctttggaaaaggt---------------atggtttggagattacttcaagggagactagcatctaaagaggctttggctagaa |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1051679 |
ctggttttcataaaaggctttggaaaaggtatggaaaacaaaattatggtttggagattacttcaagggagactagcatctaaagaggctttggctagaa |
1051580 |
T |
|
| Q |
304 |
gagggatgatgtc |
316 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
1051579 |
gaggggtgatgtc |
1051567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 248 - 291
Target Start/End: Original strand, 1631 - 1674
Alignment:
| Q |
248 |
tatggtttggagattacttcaagggagactagcatctaaagagg |
291 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
1631 |
tatggtttggagattactttaagggggactagcaactaaagagg |
1674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University