View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7446_low_5 (Length: 333)
Name: NF7446_low_5
Description: NF7446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7446_low_5 |
 | |
|
| [»] scaffold0004 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0004 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 319
Target Start/End: Original strand, 373382 - 373684
Alignment:
| Q |
19 |
aagtaatcacacgttgccactcttggcgtatcaaatgctatttccttgaattgagtttgttactctctcttgtcgctgaagtcttcttacaaggtgaaac |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373382 |
aagtaatcacacgtagccactcttggcgtatcaaatgctatttccttgaattgagtttgttactctctcttgtcgctgaagtcttcttacaaggtgaaac |
373481 |
T |
|
| Q |
119 |
atttagaactttcggaaagaatttccaacgtaagagaaagaaagaacatacacagcacaacaatctccatttccgc--nnnnnnngttcttgacgggtac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
373482 |
atttagaactttcggaaagaatttccaacgtaagagaaagaaagaacatacacaacacaacaatctccattttcgctttttttttgttcttgacgggtac |
373581 |
T |
|
| Q |
217 |
gatgataatttctctttttcttttccctctttgcgttggtgtgtgtttagtatcgttcttcatgcgtttttgtcttgggaaattagttccatcgttgtga |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
373582 |
gatgataatttctctttttcttttccctctttgcgttggtgtgcgtttagtattgttcttcatgcgtttttgtcttgggaaattagttccatcgttgtga |
373681 |
T |
|
| Q |
317 |
tgt |
319 |
Q |
| |
|
||| |
|
|
| T |
373682 |
tgt |
373684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University