View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7446_low_6 (Length: 312)
Name: NF7446_low_6
Description: NF7446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7446_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 24 - 294
Target Start/End: Complemental strand, 19339520 - 19339251
Alignment:
| Q |
24 |
tgatcctagcaagttagaagctgcgaaatggacagtactttccgatgtcaaactactccatgtatttttacgcctcattggatattatggtcgctttatc |
123 |
Q |
| |
|
|||||||||||||||||||| |||||||| | |||| |||| ||||||||| ||||||| |||| || ||||| | ||||||||| ||||||||||| |
|
|
| T |
19339520 |
tgatcctagcaagttagaagttgcgaaattggtggtaccttccaatgtcaaacaactccatccatttctaggcctcgtcggatattatcgtcgctttatc |
19339421 |
T |
 |
| Q |
124 |
accaactatgccggcattaatgcctcctgaccgatctactgcatcacggttccttcatttggccccgagtagccgttgcgatctttgaagctcttcaagg |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
19339420 |
accaactatgccggcattaatgcctcccgaccgatctactgcatcacggttccttcatttggcctcgagtagccgttgcgacctttgaagctcttcaagg |
19339321 |
T |
 |
| Q |
224 |
tactatggtgctagtccagttttttcttttggatctccttgatttttcaaagacattgttattgaaattgg |
294 |
Q |
| |
|
| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19339320 |
tgctatggtgctagt-cagttttttcttttggatctccttgatttttcaaagacattgttattgaaattgg |
19339251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University