View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7447_high_16 (Length: 250)
Name: NF7447_high_16
Description: NF7447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7447_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 41635477 - 41635236
Alignment:
| Q |
1 |
ccttgacaatccttgtgaatctggtaatagtaacaagtcttcaaaagagggtgacaggtatatgagctcgaacgggagacaacatgggtcagacgaactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41635477 |
ccttgacaatccttgtgaatctggtaatagtaacaagtcttcaaaagagggtgacaggtatatgagctcgaacgggagacaacatgggtcagacgaactg |
41635378 |
T |
 |
| Q |
101 |
tatgattctcgtatggattctacacaagtatccaatagaagtttatcttggaaaggacgccatcattctccccgttctcttgaaaaatacaagatttcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41635377 |
tatgattctcgtatggattctacacaagtatccaatagaagtttgtcttggaaaggacgccatcattctccccgttctcttgaaaaatacaagatttcta |
41635278 |
T |
 |
| Q |
201 |
atatgaaaaggcaaaacagtttttcatctgccagttcttctc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41635277 |
atatgaaaaggcaaaacagtttttcatctgccagttcttctc |
41635236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University