View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7447_low_20 (Length: 215)

Name: NF7447_low_20
Description: NF7447
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7447_low_20
NF7447_low_20
[»] chr4 (1 HSPs)
chr4 (16-202)||(34681489-34681675)
[»] chr2 (2 HSPs)
chr2 (22-199)||(10831172-10831349)
chr2 (45-81)||(40754678-40754714)
[»] chr6 (1 HSPs)
chr6 (16-68)||(33598897-33598949)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 16 - 202
Target Start/End: Original strand, 34681489 - 34681675
Alignment:
16 atatccttttcaattgtgctgttttatggtcgatttggagtgagtcgttgaaatggctcggtgtttcggctgtttttgttgaaggaggatttgagcgtct 115  Q
    |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
34681489 atatcctttttaatcgtgctgttttatggtcgatttggagtgagtcgttgaaatggctcggtgttttggctgtttttgttgaaggaggatttgagcgtct 34681588  T
116 cattttgttcaaaggtctagttgcaggaggtaaaaccgtctgtgagaggttgggagtgatattggtctccattatctcttccatttg 202  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
34681589 cattttgttcaaaggtctagttgcaggaggtaaaaccgtttgtgagaggttgggagtgatattggtctccattatctcttccatttg 34681675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 22 - 199
Target Start/End: Original strand, 10831172 - 10831349
Alignment:
22 ttttcaattgtgctgttttatggtcgatttggagtgagtcgttgaaatggctcggtgtttcggctgtttttgttgaaggaggatttgagcgtctcatttt 121  Q
    |||| ||||||||| |||| | |  ||||||| | ||||||||||| | |||||||||||| | ||||||||||||||| |||||||||| ||| | |||    
10831172 tttttaattgtgctattttgtcgatgatttggcgcgagtcgttgaagtagctcggtgtttcaggtgtttttgttgaagggggatttgagcatctaaattt 10831271  T
122 gttcaaaggtctagttgcaggaggtaaaaccgtctgtgagaggttgggagtgatattggtctccattatctcttccat 199  Q
    |||||||||| | ||||| |||||||||| |||   ||||||| |||| || || | |||||| ||||||||||||||    
10831272 gttcaaaggtttggttgctggaggtaaaaacgttcttgagaggctgggtgtaatctaggtctcaattatctcttccat 10831349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 45 - 81
Target Start/End: Original strand, 40754678 - 40754714
Alignment:
45 tcgatttggagtgagtcgttgaaatggctcggtgttt 81  Q
    ||||||||||||||| |||||||||||||||| ||||    
40754678 tcgatttggagtgagacgttgaaatggctcggagttt 40754714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 68
Target Start/End: Complemental strand, 33598949 - 33598897
Alignment:
16 atatccttttcaattgtgctgttttatggtcgatttggagtgagtcgttgaaa 68  Q
    ||||| |||| |||||| || |||||| ||| |||||||||||||||||||||    
33598949 atatcttttttaattgttctattttatcgtcaatttggagtgagtcgttgaaa 33598897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University