View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7448_high_3 (Length: 202)
Name: NF7448_high_3
Description: NF7448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7448_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 18 - 190
Target Start/End: Original strand, 36485324 - 36485496
Alignment:
| Q |
18 |
aatgaataagttcttccttccattcaagagtagaaactacacctaagtacttagaaggatttcgataattgagtaaggttccattttaatgctcgata-- |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36485324 |
aatgaataagttcttccttccattcaagagtagatactacacctaagtacttagaaggatttcgataattgagtaaggttccattttaatgctcgatagt |
36485423 |
T |
 |
| Q |
116 |
gtgtttgtcacatacttagtacattaattttgtaannnnnnnnncttcttcaaagtttagagattttagtattat |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
36485424 |
gtgtttgtcacatacttagtacattaattttgcaatttttttt--ttcttcaaagtttagagattttagtattat |
36485496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University