View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7448_low_7 (Length: 240)
Name: NF7448_low_7
Description: NF7448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7448_low_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 37087507 - 37087304
Alignment:
| Q |
19 |
atggagttgattagttaagtgtgcattatgtgaattaggaggtgatgctataagtgaaacagtagggagcagtgatgatgagtgcattggagagaaaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37087507 |
atggagttgattagttaagtgtgcattatgtgaattaggaggtgatgctataagtgaaacagtagggagcagtgatgatgagtgcattggagaggaaaaa |
37087408 |
T |
|
| Q |
119 |
tattgaacttgattgaaggtctaagttgtgctcactttgtagcttaagtttgttagcatagttggttttgcactgcttcatatgtgttgtttcattgcag |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
37087407 |
tattggacttgattgaaggtctaagttgtgctcactttgtagcttaagtttgttagcatagttggttttgcgctgcttcatatgcgttgtttcattgcag |
37087308 |
T |
|
| Q |
219 |
ttat |
222 |
Q |
| |
|
|||| |
|
|
| T |
37087307 |
ttat |
37087304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University