View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7450_high_5 (Length: 308)
Name: NF7450_high_5
Description: NF7450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7450_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 295
Target Start/End: Complemental strand, 33711057 - 33710762
Alignment:
| Q |
1 |
ggggttggtgaatgttaatgaacagatggcaacaatttcaccttctttggatatgttgtaaatggcatttgtgaggaatatgtatataacgttctacatt |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||| || ||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
33711057 |
ggggttggtgaatggtaatgaacagatgacaacaatgtcttcttctgtggatatgttgtaaatggcatttgtgaggaatatgtgtataacgttctacatt |
33710958 |
T |
 |
| Q |
101 |
ttagctattgtttgtagttcacnnnnnnnn-gttaagttgttcggtaactagaatttcattgtcttaaagtgaatcaataacttgtccgttgtatataaa |
199 |
Q |
| |
|
||| |||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33710957 |
ttatctattgtttgtagttcactttttttttgttaagttgttcggtaactagaattatattgtcttaaagtgaatcaataacttatccgttgtatataaa |
33710858 |
T |
 |
| Q |
200 |
atacaatgttcatataaactgacttaagctcacggaacaatttgtgattcatttttattcaagagtttatttatttaagttcttgttgtactcttc |
295 |
Q |
| |
|
||| ||||| ||||||||| ||||||| |||||| | |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33710857 |
atataatgtccatataaaccgacttaaattcacgggataatttgtggttcatttttattcaagagtttatttatttaagttcttgttgtactcttc |
33710762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University