View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7450_high_8 (Length: 237)
Name: NF7450_high_8
Description: NF7450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7450_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 154 - 226
Target Start/End: Complemental strand, 30997936 - 30997864
Alignment:
| Q |
154 |
ttgtcctaccttggttttgttctttcagaacaacacaacatgaataaagtttggcttcttgtactaatgatgt |
226 |
Q |
| |
|
|||||||||||| ||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30997936 |
ttgtcctacctttgttctgttcttgcagaacaacacaacatgaataaagtttggcttcttgtactaatgatgt |
30997864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University