View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7450_low_13 (Length: 264)
Name: NF7450_low_13
Description: NF7450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7450_low_13 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 6 - 264
Target Start/End: Complemental strand, 8046189 - 8045934
Alignment:
| Q |
6 |
tttcgtggtatcaaataattgtttctgaaaattatgctcactattgtttggtacaatatcactttcaatatatcatataataacattataatacctcttg |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || || |
|
|
| T |
8046189 |
tttcatggtatcaaataattgtttctgaaaattatgttcactattgtttggtacaatatcactttcaatatatcatataa---cattataatacttcatg |
8046093 |
T |
|
| Q |
106 |
tagatctgtcagttaacagttgctagtttattttgttgcgatggatcacacaaagctaaacagtttacaggccttcatgcaaggagcatgcagaatatta |
205 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8046092 |
tagatgtgtcagttaacagttgctagtttattttgttacgatggatcacacaaagctaaacagtttacaggccttcatgcaaggagcatgcagaatatta |
8045993 |
T |
|
| Q |
206 |
tagaaatgttgttgaatactataaaaatctggaccagataccgaaaattaaatcttaat |
264 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
8045992 |
tagatatgttgttgaatactataaaaatctggatcagataccgaaaattaaatcttaat |
8045934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University