View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7450_low_14 (Length: 251)
Name: NF7450_low_14
Description: NF7450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7450_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 5217267 - 5217492
Alignment:
| Q |
11 |
tggacatcaaagacgtttttcattagaaatgtcagtgttatgacataatatattatgggtttttctatcatnnnnnnnnnnnnngttgctaaagaagtta |
110 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5217267 |
tggacaccaaagacgtttttcaacagaaatgttagtgttatgacgtaatatattatgggtttttctatcataaaaaaaaaaaaagttgctaaagaagtta |
5217366 |
T |
 |
| Q |
111 |
gtaaccataagttactagtaaccaaagcattttgacttttcttatgaaaaagagtaacatttatttaattataatgagaattgtattgaatgttgccgac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
5217367 |
gtaaccataagttactagtaaccaaagcattttgacttttcttatgaaaaagagtaacatttatttaattataatgagaatggtcttgaatgttgccgac |
5217466 |
T |
 |
| Q |
211 |
aatatatacaggttgatagtgcaaac |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5217467 |
aatatatacaggttgatagtgcaaac |
5217492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University