View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7452_high_5 (Length: 232)
Name: NF7452_high_5
Description: NF7452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7452_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 882860 - 882652
Alignment:
| Q |
16 |
gaatataggcatgtgcaaacagactacttacaacacctttagtttctatgttgcctgcggttacatctacaacacacctttnnnnnnntcttaatttctc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
882860 |
gaatataggcatgtgcaaacagactacttacaacacctttagtttctatgttgcctgcggttacatctacaacacacctttaaaaaaatcttaatttctc |
882761 |
T |
 |
| Q |
116 |
ctattctggctcag--aatggcc------ttgagatggtgtcttaaattagatcatagtattttagattgtattattatccctctatatgagaattaatg |
207 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
882760 |
ctattctggctcaggcaatggccttgaggttgagatggtgtcttaaattagatcatagaatttcagattgtattattatccctctatatgagaattaatg |
882661 |
T |
 |
| Q |
208 |
tcaatgttg |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
882660 |
tcaatgttg |
882652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University