View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7452_low_7 (Length: 276)
Name: NF7452_low_7
Description: NF7452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7452_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 15 - 244
Target Start/End: Original strand, 21660773 - 21661000
Alignment:
| Q |
15 |
cagagacgatctccaagtagagtgaaaatttgcacccttatttttgctactgcataataacaaaggatccaagttgcacaataaattgtactt-aaatcc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21660773 |
cagagacgatctccaagtagagtgaaaatttgcacccttatttttgctactgcataataacaaaggatccaagttgcacaataaattgtacttaaaatcc |
21660872 |
T |
 |
| Q |
114 |
aatttaataactnnnnnnncatatgtcgtctgatcttcatccaacaatcaaaacttgcttctagcacaaaactcataactccaaagaatccatttccaaa |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||| ||||| ||||| | | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21660873 |
aatttaataact-aaaaaacacatgtcgtctgatcttcatccaacaaacaaaatttgctccaa--acaaaactcataactccaaagaatccatttccaaa |
21660969 |
T |
 |
| Q |
214 |
taggacagatcctccttaggcctttacaaaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21660970 |
taggacagatcctccttaggcctttacaaaa |
21661000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University