View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7453_high_5 (Length: 247)
Name: NF7453_high_5
Description: NF7453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7453_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 13 - 228
Target Start/End: Original strand, 38196136 - 38196351
Alignment:
| Q |
13 |
aatatgtgtatagaatgtgcatgaacccaattgtttgagtaagtcatataagatgttgtaccttttccttggcaaagtcttgtcaaagatggtaaaaact |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38196136 |
aatatgtgtatagaatgtgcatgaacccaattgtttgagtaagtcatataagatgttgtaccttttctttggcaaagtcttgtcaaagatggtaaaaact |
38196235 |
T |
 |
| Q |
113 |
gagtcaaattctcagaaagaatgtaaaggaaattaattcaagttgccaagggaaaaacattattgggatttgggaactagaatgcaacacgtcacttgaa |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38196236 |
gagtcaaattctcagaaagaatgtaaaggaaattaattcaagttgccaaggtaaaaacattattgggatttgggaactagaatgcaacacgtcacttgaa |
38196335 |
T |
 |
| Q |
213 |
aatcgtttgaaaaaca |
228 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38196336 |
aatcgtttgaaaaaca |
38196351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University