View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7453_low_9 (Length: 202)
Name: NF7453_low_9
Description: NF7453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7453_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 14 - 185
Target Start/End: Original strand, 34348756 - 34348927
Alignment:
| Q |
14 |
ttggtgttattagggtgaatcttcaaatggtagtttgtatactaccgaagtgttgcttgagggttgcacctctttgtcttaacctggaaatcgaccatgg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| || |
|
|
| T |
34348756 |
ttggtgttattagggtgaatcttcaaatggtagtttgtatactaccgaagtgttgcttgagggttgtacctctttgtcttaacttggaaatcgaccaagg |
34348855 |
T |
|
| Q |
114 |
agctatagtaaatatgatccggtggacattgacgtgcaaggactttaagagatagatgatcatcctcgatat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
34348856 |
agctatagtaaatatgatccggtggacattgacgtgcaaggactttaagagagagatgatcgtccgcgatat |
34348927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University