View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7454_low_1 (Length: 252)
Name: NF7454_low_1
Description: NF7454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7454_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 10680262 - 10680028
Alignment:
| Q |
1 |
cagtcaacattttgaagaagcaatggactggacaaccacccttcttttgtaccgcaccatagcgggggacaaagttttttcctttattctcttaaataaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680262 |
cagtcaacattttgaagaagcaatggactggacaaccacccttcttttgtaccgcaccatagcgggggacaaagttttttcctttattctcttaaataaa |
10680163 |
T |
 |
| Q |
101 |
tgagaaatacttttatctttgtcgtttaatctcttcagataattctttcaattatctttagtcttttctcagttatctttattttcttcctgctttgcgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10680162 |
tgagaaatacttttatctttgtcgtttaatctcttcagataattctttcaattatctctagtcttttcccagttatctttattttcttcctgctttgcgt |
10680063 |
T |
 |
| Q |
201 |
gtgtgtgttaggatgatgattacgatgtcactttt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680062 |
gtgtgtgttaggatgatgattacgatgtcactttt |
10680028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 40 - 74
Target Start/End: Complemental strand, 10680297 - 10680263
Alignment:
| Q |
40 |
ccttcttttgtaccgcaccatagcgggggacaaag |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10680297 |
ccttcttttgtaccgcaccatagcgggggacaaag |
10680263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 4269037 - 4268974
Alignment:
| Q |
15 |
aagaagcaatggactggacaaccacccttcttttgtaccgcaccatagcgggggacaaagtttt |
78 |
Q |
| |
|
||||||| | |||||||||||||||| || | ||||||||||||| ||| | |||||||||||| |
|
|
| T |
4269037 |
aagaagcgagggactggacaaccaccgttttattgtaccgcaccaaagcagtggacaaagtttt |
4268974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University