View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7455_low_3 (Length: 399)

Name: NF7455_low_3
Description: NF7455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7455_low_3
NF7455_low_3
[»] chr7 (15 HSPs)
chr7 (51-188)||(23771099-23771236)
chr7 (48-188)||(9672115-9672255)
chr7 (48-188)||(46421408-46421548)
chr7 (48-187)||(27306778-27306917)
chr7 (48-187)||(26174327-26174466)
chr7 (48-188)||(32664058-32664198)
chr7 (48-188)||(10668413-10668553)
chr7 (48-189)||(21741087-21741228)
chr7 (48-188)||(7918054-7918194)
chr7 (48-188)||(19762553-19762693)
chr7 (54-188)||(1535646-1535780)
chr7 (48-134)||(41200381-41200467)
chr7 (48-190)||(38701963-38702105)
chr7 (103-188)||(18333673-18333758)
chr7 (103-188)||(23361066-23361151)
[»] chr2 (12 HSPs)
chr2 (51-188)||(33056201-33056338)
chr2 (51-188)||(1698647-1698784)
chr2 (48-188)||(17899406-17899546)
chr2 (48-187)||(1590338-1590477)
chr2 (48-189)||(7093771-7093912)
chr2 (54-188)||(39820146-39820280)
chr2 (48-188)||(5009524-5009664)
chr2 (103-188)||(11880190-11880275)
chr2 (103-188)||(37363227-37363312)
chr2 (54-188)||(18165831-18165965)
chr2 (48-188)||(35601323-35601463)
chr2 (106-188)||(40657143-40657225)
[»] scaffold1371 (1 HSPs)
scaffold1371 (48-188)||(79-219)
[»] chr4 (14 HSPs)
chr4 (52-188)||(37746692-37746828)
chr4 (48-182)||(34342818-34342952)
chr4 (48-188)||(16606842-16606982)
chr4 (48-188)||(5324406-5324546)
chr4 (48-188)||(46042611-46042751)
chr4 (48-182)||(10319045-10319179)
chr4 (48-188)||(53916370-53916509)
chr4 (61-162)||(18913320-18913421)
chr4 (48-188)||(20359625-20359765)
chr4 (48-182)||(16922639-16922773)
chr4 (48-187)||(25353728-25353866)
chr4 (54-188)||(5165978-5166112)
chr4 (103-188)||(38965050-38965135)
chr4 (48-188)||(32216606-32216746)
[»] scaffold0122 (1 HSPs)
scaffold0122 (48-188)||(45045-45185)
[»] chr6 (11 HSPs)
chr6 (48-188)||(13336777-13336917)
chr6 (48-188)||(17307302-17307442)
chr6 (48-180)||(28904294-28904426)
chr6 (299-383)||(23127600-23127684)
chr6 (48-188)||(20107643-20107783)
chr6 (48-188)||(31521743-31521883)
chr6 (48-189)||(4442740-4442881)
chr6 (48-188)||(21739224-21739364)
chr6 (103-188)||(28695426-28695511)
chr6 (48-188)||(13527614-13527754)
chr6 (48-188)||(4970380-4970519)
[»] chr8 (8 HSPs)
chr8 (54-188)||(17906001-17906135)
chr8 (48-189)||(31323619-31323760)
chr8 (48-188)||(35067431-35067571)
chr8 (86-190)||(44464211-44464315)
chr8 (86-190)||(44471742-44471846)
chr8 (48-114)||(35629819-35629885)
chr8 (48-188)||(9765109-9765249)
chr8 (54-134)||(3540762-3540842)
[»] chr5 (4 HSPs)
chr5 (48-188)||(36394830-36394970)
chr5 (48-188)||(2062102-2062242)
chr5 (48-188)||(37566554-37566694)
chr5 (48-188)||(33871774-33871914)
[»] chr3 (15 HSPs)
chr3 (48-188)||(23705921-23706061)
chr3 (48-188)||(23724377-23724517)
chr3 (48-188)||(23742833-23742973)
chr3 (48-188)||(18553061-18553201)
chr3 (48-188)||(15858842-15858982)
chr3 (48-178)||(29723153-29723283)
chr3 (48-188)||(6580706-6580846)
chr3 (57-188)||(47167400-47167531)
chr3 (52-188)||(20858885-20859021)
chr3 (48-200)||(32928098-32928251)
chr3 (48-188)||(33900729-33900869)
chr3 (51-157)||(985382-985488)
chr3 (103-188)||(26250115-26250200)
chr3 (57-124)||(46831795-46831862)
chr3 (111-188)||(889322-889399)
[»] scaffold0573 (1 HSPs)
scaffold0573 (48-180)||(5374-5506)
[»] chr1 (7 HSPs)
chr1 (48-187)||(26979677-26979816)
chr1 (48-188)||(44409352-44409492)
chr1 (54-187)||(45876651-45876784)
chr1 (48-188)||(2397666-2397806)
chr1 (48-188)||(20337143-20337283)
chr1 (48-187)||(1859548-1859686)
chr1 (103-188)||(49326128-49326214)
[»] scaffold0669 (1 HSPs)
scaffold0669 (48-189)||(5266-5407)
[»] scaffold0164 (1 HSPs)
scaffold0164 (48-188)||(971-1111)
[»] scaffold0044 (1 HSPs)
scaffold0044 (54-140)||(92431-92517)


Alignment Details
Target: chr7 (Bit Score: 110; Significance: 3e-55; HSPs: 15)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 51 - 188
Target Start/End: Original strand, 23771099 - 23771236
Alignment:
Q  51 tggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaag 150  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||    
T  23771099 tggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctgggaaattccctcacaaacgtcccttttcccagggattctgaccttttgacaag 23771198  T
Q  151 gattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | |||||||||| ||||| ||||||||||||| |||||    
T  23771199 ggttttgcccctggcaaaaggtaatgtttcttgtagtg 23771236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 9672115 - 9672255
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||| |    
T  9672115 ccctggcaaaatgtttgcgacgagcgcttttgccagtacttccgcccctggcaaattccctcacaaacatcccttttcccagggattctgtccttttgtc 9672214  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  9672215 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 9672255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 46421408 - 46421548
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||    
T  46421408 ccctggcaaaatgtttacgacgagcgcttttgccattgcttctgcccctgggaaattccctcacaaacgtcccttttcccagggattctgtccttttgac 46421507  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||| |||| ||||| ||||| ||||| ||||||| |||||    
T  46421508 aagggtttttcccctggcaaaaggtaacgtttcttgtagtg 46421548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 48 - 187
Target Start/End: Complemental strand, 27306917 - 27306778
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||||||||||||||||||||||| | ||| ||||||||| ||||||||||||||||||||||||| |||||||||||||||||||  |    
T  27306917 ccctggcaaaatgtttgcgacgagcgcttttgccagtactttcgcccctggcaaattccctcacaaacgtcccttttcccagggattctgtccttttctc 27306818  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagt 187  Q
    | ||||||||||||| ||||| ||||||||||||| ||||    
T  27306817 agggattttgcccctggcaaaaggtaatgtttcttgtagt 27306778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 48 - 187
Target Start/End: Original strand, 26174327 - 26174466
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||| ||||||||||||||||||| ||||||| ||||||| |||||||||||||||||||| |||| ||||||||| ||||||||||||    
T  26174327 ccctggcaaaatgttagcgacgagcgcttttgccactgcttccacccctgggaaattccctcacaaacgtccattttcccagggattttgtccttttgac 26174426  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagt 187  Q
    ||||  |||||||||| |||| ||||||||||||| ||||    
T  26174427 aagggatttgcccctaacaaaaggtaatgtttcttgtagt 26174466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 32664058 - 32664198
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| ||| |||||||| | |||||||  ||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||  |    
T  32664058 ccctggcaaaaagttagcgacgagtggttttgcccatgcttccgcccctagcaaattccctcacaaacgtcccttttcccagggattctgtccttttctc 32664157  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||||||||  |||| ||||||||||||| |||||    
T  32664158 aaggattttgcccctgacaaaaggtaatgtttcttgtagtg 32664198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 10668413 - 10668553
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||||||||||||||| |||||||||||| ||||| || |||| | ||||||||||||||||||||||||| ||||||||| |||||||||  |    
T  10668413 ccctggcaaaatgtttgcgacgggcgcttttgccagtgctttcgtccctagcaaattccctcacaaacgtcccttttcccagggattttgtccttttctc 10668512  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | |||||||| ||||  |||| ||||||||||||| |||||    
T  10668513 agggattttgtccctgacaaaaggtaatgtttcttgtagtg 10668553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 48 - 189
Target Start/End: Complemental strand, 21741228 - 21741087
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| ||||||||| |||||||||| |||||||| |||||| |||||||| |||||||| | ||||||||||||||| || |||||||||||||||  |    
T  21741228 ccctgacaaaatgttagcgacgagcggttttgccagtgcttctgcccctggcaaattcccacgcaaacgtcccttttttcaaggattctgtccttttctc 21741129  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtgg 189  Q
    |  |||||| ||||| ||||| ||||||||||||| ||||||    
T  21741128 agagattttacccctggcaaaaggtaatgtttcttgtagtgg 21741087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 7918054 - 7918194
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||||||||||||| ||| |||||||| |||||||| || | ||| |  |||||||||||| ||| | ||| ||||||||| ||||||||||||    
T  7918054 ccctggcaaaatgtttgcgatgagtgcttttgcgattgcttctgctcttggcattttccctcacaaatgtcgcgtttcccagggattgtgtccttttgac 7918153  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | |||||||||||||| |||| ||||||||||||| |||||    
T  7918154 agggattttgcccctaacaaaaggtaatgtttcttgtagtg 7918194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 19762693 - 19762553
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||||||    
T  19762693 ccctggcaaagtgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccgtttgccagggattttgtccttttgac 19762594  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | | ||||||||||| ||||| ||||||||||||| |||||    
T  19762593 aggtattttgcccctggcaaaaggtaatgtttcttgtagtg 19762553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 54 - 188
Target Start/End: Original strand, 1535646 - 1535780
Alignment:
Q  54 caaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggat 153  Q
    ||||||||| |||| ||||  ||||||||  | |||||||||||| |||| |||||||||||||||||||| | |||||||||||| ||||  || ||||    
T  1535646 caaaatgttagcgatgagctgttttgccagggtttccgcccctggcaaatgccctcacaaacgtcccttttcctagggattctgtcattttctcagggat 1535745  T
Q  154 tttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    ||||||||| |||||  | |||||||||| |||||    
T  1535746 tttgcccctggcaaaatgcaatgtttcttgtagtg 1535780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 48 - 134
Target Start/End: Complemental strand, 41200467 - 41200381
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggatt 134  Q
    ||||||||||| |||||||| |||||||||||||| |||||||||||||||    |||||||||||||||||||||| |||||||||    
T  41200467 ccctggcaaaaggtttgcgatgagcgcttttgccactgcttccgcccctggctttttccctcacaaacgtcccttttgccagggatt 41200381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 48 - 190
Target Start/End: Complemental strand, 38702105 - 38701963
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||  |||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| |||||| || ||||||||||||    
T  38702105 ccctggcaaagcgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccatttgccagggcttttgtccttttgac 38702006  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtgga 190  Q
    | ||||||||||||| ||||| || |||||| ||| |||||||    
T  38702005 agggattttgcccctggcaaaaggcaatgttccttgtagtgga 38701963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 103 - 188
Target Start/End: Complemental strand, 18333758 - 18333673
Alignment:
Q  103 ttccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||||| ||||| ||| ||||||||| ||||||||||||| ||||||||||||| ||||| || | |||||||| |||||    
T  18333758 ttccctcacaaatgtcccgtttgccagggattttgtccttttgacagggattttgcccctggcaaaaggcagtgtttcttgtagtg 18333673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 103 - 188
Target Start/End: Complemental strand, 23361151 - 23361066
Alignment:
Q  103 ttccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||||| ||| | ||| ||||||| | ||||||||||||| ||||||||||||| ||||| ||||||||||||| |||||    
T  23361151 ttccctcacaaatgtcgcgtttcccagggagtttgtccttttgacatggattttgcccctggcaaaaggtaatgtttcttatagtg 23361066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 106; Significance: 6e-53; HSPs: 12)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 51 - 188
Target Start/End: Complemental strand, 33056338 - 33056201
Alignment:
Q  51 tggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaag 150  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||| ||||||||||||    
T  33056338 tggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctgggaatttccctcacaaacgtcccttttcccagggattctgaccttttgacaag 33056239  T
Q  151 gattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | |||||||||| ||||| ||||||||||||| |||||    
T  33056238 ggttttgcccctggcaaaaggtaatgtttcttgtagtg 33056201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 51 - 188
Target Start/End: Original strand, 1698647 - 1698784
Alignment:
Q  51 tggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaag 150  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||    
T  1698647 tggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctgggaaattccctcacaaacgtcccttttcccagggattctgaccttttgacaag 1698746  T
Q  151 gattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | |||||||||| |||||  | |||||||||| |||||    
T  1698747 ggttttgcccctggcaaaatgcaatgtttcttgtagtg 1698784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 17899546 - 17899406
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| |||||||||||||| | |||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  17899546 ccctggcaaaaggtttgcgatgagcgcttttgccactacttccgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 17899447  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  17899446 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 17899406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 48 - 187
Target Start/End: Original strand, 1590338 - 1590477
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| ||||||||| ||||||||||||||||| | ||||||||||||||| ||||||||||||||||||||| |||  ||||||||||||||||||  |    
T  1590338 ccctgacaaaatgttagcgacgagcgcttttgcgagtgcttccgcccctgggaaattccctcacaaacgtcccgtttgtcagggattctgtccttttctc 1590437  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagt 187  Q
    | | ||||||||||||||||| ||||||||||||| ||||    
T  1590438 aggaattttgcccctagcaaaaggtaatgtttcttgtagt 1590477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 48 - 189
Target Start/End: Complemental strand, 7093912 - 7093771
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||||||||||||| ||| |||||||| |||||||| |||||||| |  |||||||||||| ||| | ||| ||||||||| || |||||||||    
T  7093912 ccctggcaaaatgtttgcgatgagtgcttttgcgattgcttctgcccctggcattttccctcacaaatgtcgcgtttcccagggattttgaccttttgac 7093813  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtgg 189  Q
    | ||||||||||||| ||||| ||||||||||||| ||||||    
T  7093812 agggattttgcccctggcaaaaggtaatgtttcttgtagtgg 7093771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 54 - 188
Target Start/End: Complemental strand, 39820280 - 39820146
Alignment:
Q  54 caaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggat 153  Q
    ||||||||| |||||||||  ||||||||  | |||||||||||| |||| |||||||||||||||||||| |||||||||||||| ||||  || ||||    
T  39820280 caaaatgttagcgacgagctgttttgccagggtttccgcccctggcaaatgccctcacaaacgtcccttttcccagggattctgtcattttctcagggat 39820181  T
Q  154 tttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    ||||||||| || ||  | |||||||||| |||||    
T  39820180 tttgcccctggcgaaatgcaatgtttcttgtagtg 39820146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 5009664 - 5009524
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||||||    
T  5009664 ccctggcaaagtgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccgtttgccagggattttgtccttttgac 5009565  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| || |||||| ||| |||||    
T  5009564 agggattttgcccctggcaaaaggcaatgttccttgtagtg 5009524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 103 - 188
Target Start/End: Complemental strand, 11880275 - 11880190
Alignment:
Q  103 ttccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||||| ||| | ||| ||||||||| ||||||||||||| ||||||||||||| ||||| ||||||||||||| |||||    
T  11880275 ttccctcacaaatgtcgcgtttcccagggattatgtccttttgacagggattttgcccctggcaaaaggtaatgtttcttgtagtg 11880190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 103 - 188
Target Start/End: Complemental strand, 37363312 - 37363227
Alignment:
Q  103 ttccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||||| ||| | ||| ||||||||| ||||||||||||| ||||||||||||| ||||| ||||||||||||| |||||    
T  37363312 ttccctcacaaatgtcgcgtttcccagggattatgtccttttgacagggattttgcccctggcaaaaggtaatgtttcttgtagtg 37363227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 54 - 188
Target Start/End: Original strand, 18165831 - 18165965
Alignment:
Q  54 caaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggat 153  Q
    |||||||||||||||||    ||||||||  | ||| | |||||| |||| |||||||||||||||||||| ||||| |||||||||||||  ||   ||    
T  18165831 caaaatgtttgcgacgaagtgttttgccagggtttcggtccctggcaaatgccctcacaaacgtcccttttcccaggaattctgtccttttctcagaaat 18165930  T
Q  154 tttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||||||||  | |||||||||| |||||    
T  18165931 tttgcccctagcaaaatgcaatgtttcttgtagtg 18165965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 35601323 - 35601463
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||||| ||||||||||||||   | || |||||| |    ||||||| |||| ||||| ||| ||||||||| ||||||||||||    
T  35601323 ccctggcaaagtgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcccaaatgtcccgtttgccagggattttgtccttttgac 35601422  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | |||||||||||||  |||| || |||||| ||| |||||    
T  35601423 agggattttgcccctgacaaaaggcaatgttccttgtagtg 35601463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 106 - 188
Target Start/End: Original strand, 40657143 - 40657225
Alignment:
Q  106 cctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    ||||||||| ||||| ||| |||||| || ||||||||||||| ||||||||||||| ||||| || | |||||||| |||||    
T  40657143 cctcacaaatgtcccgtttgccagggcttttgtccttttgacagggattttgcccctggcaaaaggcagtgtttcttgtagtg 40657225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1371 (Bit Score: 101; Significance: 6e-50; HSPs: 1)
Name: scaffold1371
Description:

Target: scaffold1371; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 219 - 79
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||||||||||||| |||||||| |||||||||||||||||||| |    
T  219 ccctggcaaaatgtttgcgacgagcgcttttgccagtacttccgcccctggcaaattccctcacaaacatcccttttcccagggattctgtccttttgtc 120  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  119 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 79  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 101; Significance: 6e-50; HSPs: 14)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 52 - 188
Target Start/End: Original strand, 37746692 - 37746828
Alignment:
Q  52 ggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaagg 151  Q
    |||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| | ||||| ||||||||||||||| ||    
T  37746692 ggcaaaatgtttgcgacgagcgcttttgccattgcttctgcccctggcaaattccctcacaaacgtcccttttcctagggactctgtccttttgacaggg 37746791  T
Q  152 attttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    ||||||||||| ||||| ||||||||||||| |||||    
T  37746792 attttgcccctggcaaaaggtaatgtttcttgtagtg 37746828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 48 - 182
Target Start/End: Complemental strand, 34342952 - 34342818
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||| ||||||||| ||||| ||| ||||||||||||    
T  34342952 ccctggcaaaatgtttgcgacgagcgcttttgccattgctttcgctcctgggaaattccctcacaaatgtcccttttcccaggaattatgtccttttgac 34342853  T
Q  148 aaggattttgcccctagcaaatggtaatgtttctt 182  Q
    |||||||||||  || ||||| |||||||||||||    
T  34342852 aaggattttgcttctggcaaaaggtaatgtttctt 34342818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 16606982 - 16606842
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||||||||||||||||||||||| |  |||||||||||| |||||||||||||||| |||||||| || ||||||||||||||||  |    
T  16606982 ccctggcaaaatgtttgcgacgagcgcttttgccagtatttccgcccctggcaaattccctcacaaacatcccttttccctgggattctgtccttttctc 16606883  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  16606882 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 16606842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 5324406 - 5324546
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||||  ||||||| ||||||||||||||||||||| ||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  5324406 ccctggcaaaacttttgcgatgagcgcttttgccattgcttctgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 5324505  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | |||||||||||||  |||| ||||||||||||| |||||    
T  5324506 agggattttgcccctgacaaaaggtaatgtttcttgtagtg 5324546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 46042751 - 46042611
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||| |||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||  ||||||||||||||||||  |    
T  46042751 ccctggcaaaatgttagcgacgagcggttttgccagtgcttccgcccctggcaaattccctcacaaacgtcccttttctcagggattctgtccttttctc 46042652  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | | |||||||| || ||||| |||||| |||||| |||||    
T  46042651 aggaattttgccactggcaaaaggtaatatttcttgtagtg 46042611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 48 - 182
Target Start/End: Complemental strand, 10319179 - 10319045
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||| ||||||||||||||||||||| | ||||||||||||| |||||||||||| ||||||| |||| |||||||||||||||||||       
T  10319179 ccctggcaaaatggttgcgacgagcgcttttgccagtacttccgcccctggcaaattccctcactaacgtcctttttcccagggattctgtccttttctt 10319080  T
Q  148 aaggattttgcccctagcaaatggtaatgtttctt 182  Q
    | |||||||||||||   ||| |||||||||||||    
T  10319079 agggattttgcccctgataaaaggtaatgtttctt 10319045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 53916509 - 53916370
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| |||||| ||| |||||||||||||||||| | |||| |||||||| |||||||||||||||||||||||||| ||||||||||||| ||||  |    
T  53916509 ccctgacaaaatatttacgacgagcgcttttgccagtacttctgcccctggcaaattccctcacaaacgtcccttttttcagggattctgtcattttctc 53916410  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||| |||||  |||| ||||||||||||| |||||    
T  53916409 agggattttacccctgacaaa-ggtaatgtttcttgtagtg 53916370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 61 - 162
Target Start/End: Original strand, 18913320 - 18913421
Alignment:
Q  61 tttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgccc 160  Q
    |||||||||||||||||| ||| | |||  |||||||| |||||| ||||||||||||||||||||||||||||||||||||||  || |||||||||||    
T  18913320 tttgcgacgagcgctttttccagtacttttgcccctggcaaattctctcacaaacgtccctttttccagggattctgtccttttctcagggattttgccc 18913419  T
Q  161 ct 162  Q
    ||    
T  18913420 ct 18913421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 20359765 - 20359625
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||||| ||| |||||||| | ||| || ||||||||    |||||||||||| ||| | ||| ||||||||| ||||||||||||    
T  20359765 ccctggcaaagtgtttgcgatgagtgcttttgcgagtgcgtctgcccctggctttttccctcacaaatgtcgcgtttcccagggattttgtccttttgac 20359666  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  20359665 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 20359625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 48 - 182
Target Start/End: Complemental strand, 16922773 - 16922639
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||||||    
T  16922773 ccctggcaaagtgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccgtttgccagggattttgtccttttgac 16922674  T
Q  148 aaggattttgcccctagcaaatggtaatgtttctt 182  Q
    | ||||||||||||| ||||| |||||||||||||    
T  16922673 agggattttgcccctggcaaaaggtaatgtttctt 16922639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 48 - 187
Target Start/End: Complemental strand, 25353866 - 25353728
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||| |||||||| |||||||||| |||||||| ||||  ||||  ||| ||||||||||||||||||||||||| |||| ||||||||||||||  |    
T  25353866 ccctggaaaaatgttagcgacgagcggttttgccagtgctctcgcct-tggcaaattccctcacaaacgtcccttttcccagagattctgtccttttctc 25353768  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagt 187  Q
    |  ||||||||||||  |||| ||| ||||||||| ||||    
T  25353767 agtgattttgcccctgacaaaaggtgatgtttcttgtagt 25353728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 54 - 188
Target Start/End: Complemental strand, 5166112 - 5165978
Alignment:
Q  54 caaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggat 153  Q
    ||||||||| |||| ||||  ||||||||  | |||||||||||| ||||||||||| ||| |||||||||  ||||||||||||| ||||  || ||||    
T  5166112 caaaatgttagcgatgagctgttttgccagggtttccgcccctggcaaattccctcataaatgtcccttttctcagggattctgtcattttctcagggat 5166013  T
Q  154 tttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    ||||||||| |||||  | |||||||||| |||||    
T  5166012 tttgcccctggcaaaatgcaatgtttcttgtagtg 5165978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 103 - 188
Target Start/End: Complemental strand, 38965135 - 38965050
Alignment:
Q  103 ttccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||||| ||||| ||| ||||||||| ||||||||||||| ||||||||||||| ||||| || |||||||||| |||||    
T  38965135 ttccctcacaaatgtcccgtttgccagggattttgtccttttgacagggattttgcccctggcaaaaggcaatgtttcttgtagtg 38965050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 32216606 - 32216746
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||| | ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||| ||    
T  32216606 ccctggcaaagtgtttgcaatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccgtttgccagggattttgtccttttaac 32216705  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| || |||||||||| |||||    
T  32216706 agggattttgcccctggcaaaaggcaatgtttcttgtagtg 32216746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0122 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: scaffold0122
Description:

Target: scaffold0122; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 45185 - 45045
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| ||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||  |    
T  45185 ccctgacaaaatgtttgcgacgagcgcttttgccagtacttccgcccctggcaaattccctcacaaacgtcccttttgccagggattctgtccttttttc 45086  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  45085 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 45045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 97; Significance: 1e-47; HSPs: 11)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 13336917 - 13336777
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| ||||||||||||||||||||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  13336917 ccctggcaaaaggtttgcgatgagcgcttttgccattgcttccgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 13336818  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  13336817 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 13336777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 17307442 - 17307302
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||| ||||||||||||||||||| ||||| |||||| || ||||||||||||||||||||||||| ||||||||| ||||||||||||    
T  17307442 ccctggcaaaatgttagcgacgagcgcttttgccactgctttcgcccccgggaaattccctcacaaacgtcccttttcccagggattttgtccttttgac 17307343  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    ||||  ||||||||| ||||| ||||||||||||| |||||    
T  17307342 aaggggtttgcccctggcaaaaggtaatgtttcttgtagtg 17307302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 48 - 180
Target Start/End: Original strand, 28904294 - 28904426
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| |||||||||||||| |||||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  28904294 ccctggcaaaaggtttgcgatgagcgcttttgccactgcttccgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 28904393  T
Q  148 aaggattttgcccctagcaaatggtaatgtttc 180  Q
    | ||||||||||||| ||||| |||||||||||    
T  28904394 agggattttgcccctggcaaaaggtaatgtttc 28904426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 299 - 383
Target Start/End: Complemental strand, 23127684 - 23127600
Alignment:
Q  299 atagatgtcaatggatgtggtggttgttttctcactgaagatagttatccagactggttaggtctcggttttgaaggttcttctg 383  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  23127684 atagatgtcaatggatgtggtggttgttttctcactgaagatagttatccagactggttaggtttcggttttgaaggttcttctg 23127600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 20107643 - 20107783
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| ||||||||||| ||||||| ||||||||| | ||||||||||||| ||||||||||||||| ||||||||| ||||||||||| |||||||  |    
T  20107643 ccctgacaaaatgtttgtgacgagcacttttgccagtacttccgcccctggcaaattccctcacaaaagtcccttttcccagggattctatccttttctc 20107742  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| |||||  ||| |||||||| |||||    
T  20107743 atggattttgcccctggcaaaaagtagtgtttcttgtagtg 20107783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 31521743 - 31521883
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||||  ||||||| |||||||||||||| |||||| ||||||||    |||||||||||||||||||||| |||  |||| ||| ||||||||    
T  31521743 ccctggcaaaaattttgcgatgagcgcttttgccactgcttctgcccctggctttttccctcacaaacgtcccttttgccatcgattatgtacttttgac 31521842  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  31521843 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 31521883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 48 - 189
Target Start/End: Complemental strand, 4442881 - 4442740
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||  |||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| |||||| || ||||||||||||    
T  4442881 ccctggcaaagcgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccatttgccagggcttttgtccttttgac 4442782  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtgg 189  Q
    ||||||||||||||| ||||| || |||||| ||| ||||||    
T  4442781 aaggattttgcccctggcaaaaggcaatgttccttgtagtgg 4442740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 21739224 - 21739364
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| ||||||||  |||| ||| |||||||| | |||||| | |||||| |   ||||||||||| ||| | ||| ||||||||| ||||||||||||    
T  21739224 ccctgacaaaatgtcggcgatgagtgcttttgcgagtgcttctgtccctggcattctccctcacaaatgtcgcgtttcccagggattttgtccttttgac 21739323  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||| ||||| ||||| ||||||||||||| |||||    
T  21739324 agggatttttcccctggcaaaaggtaatgtttcttgtagtg 21739364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 103 - 188
Target Start/End: Original strand, 28695426 - 28695511
Alignment:
Q  103 ttccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||||| ||||| ||| ||||||||| ||||||||||||| ||||||||||||| ||||| || | |||||||| |||||    
T  28695426 ttccctcacaaatgtcccatttgccagggattttgtccttttgacagggattttgcccctggcaaaaggcagtgtttcttatagtg 28695511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 13527614 - 13527754
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||  |||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| |||||| || ||||||||||||    
T  13527614 ccctggcaaagcgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccatttgccagggcttttgtccttttgac 13527713  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| || |||||| ||| |||||    
T  13527714 agggattttgcccctggcaaaaggcaatgttccttgtagtg 13527754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 4970380 - 4970519
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||||||||||||| ||| ||||||||  ||||||| |||| ||  |  || ||||||||| ||| | ||| | ||||||| |||| |||||||    
T  4970380 ccctggcaaaatgtttgcgatgagtgcttttgcggttgcttctgccc-tgatatttttcctcacaaatgtcgcgtttactagggattgtgtctttttgac 4970478  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||| |||||  |||| ||||||||||||| |||||    
T  4970479 agggattttacccctgacaaaaggtaatgtttcttgtagtg 4970519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 95; Significance: 2e-46; HSPs: 8)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 54 - 188
Target Start/End: Original strand, 17906001 - 17906135
Alignment:
Q  54 caaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggat 153  Q
    ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||  |||||||    
T  17906001 caaaatgtttgcgacgagcgcttttgccaatacttccgcccctggaaaattccctcacaaatgtcccttttcccagggattctgtccttttctcaaggat 17906100  T
Q  154 tttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    ||||||||| | ||| ||||||||||||| |||||    
T  17906101 tttgcccctggaaaaaggtaatgtttcttgtagtg 17906135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 48 - 189
Target Start/End: Complemental strand, 31323760 - 31323619
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| ||||||||||||||||||||||||||||| | ||||||||| ||| ||||||||||||||||||||||||| |||||||||||||| ||||  |    
T  31323760 ccctgacaaaatgtttgcgacgagcgcttttgccagtacttccgcccttggcaaattccctcacaaacgtcccttttcccagggattctgtcattttctc 31323661  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtgg 189  Q
    ||||||||||||||||||||| ||| ||||||||| ||||||    
T  31323660 aaggattttgcccctagcaaaaggtgatgtttcttgtagtgg 31323619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 35067571 - 35067431
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||||||||||| ||||||||||| | ||||||||||||  |||||||||||||||||||| |||| |||||||||||||||||||  |    
T  35067571 ccctggcaaaatgtttgcgacgaacgcttttgccagtacttccgcccctgacaaattccctcacaaacgtccattttcccagggattctgtccttttctc 35067472  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  35067471 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 35067431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 86 - 190
Target Start/End: Original strand, 44464211 - 44464315
Alignment:
Q  86 cttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttcta 185  Q
    ||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||  || ||||||||||||| ||||| || ||||||| || ||    
T  44464211 cttccgcccctggcaaattccctcacaaatgtcccttttcccagggattctgtccttttcccagggattttgcccctggcaaaaggcaatgttttttgta 44464310  T
Q  186 gtgga 190  Q
    |||||    
T  44464311 gtgga 44464315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 86 - 190
Target Start/End: Original strand, 44471742 - 44471846
Alignment:
Q  86 cttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttcta 185  Q
    ||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||  || ||||||||||||| ||||| || ||||||| || ||    
T  44471742 cttccgcccctggcaaattccctcacaaatgtcccttttcccagggattctgtccttttcccagggattttgcccctggcaaaaggcaatgttttttgta 44471841  T
Q  186 gtgga 190  Q
    |||||    
T  44471842 gtgga 44471846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 48 - 114
Target Start/End: Complemental strand, 35629885 - 35629819
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaa 114  Q
    ||||||||||||||| ||||||||||||||||||  ||||||||||||||| |||||||||||||||    
T  35629885 ccctggcaaaatgttagcgacgagcgcttttgcctgtgcttccgcccctggcaaattccctcacaaa 35629819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 9765109 - 9765249
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||| |||||  || |||||||| | ||| || ||||||||    |||| ||||||| ||| | ||| ||| ||||| ||||||||||||    
T  9765109 ccctggcaaagtgtctgcgataagtgcttttgcgagtgcgtctgcccctggctttttccgtcacaaatgtcgcgtttcccatggattttgtccttttgac 9765208  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  9765209 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 9765249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 54 - 134
Target Start/End: Original strand, 3540762 - 3540842
Alignment:
Q  54 caaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggatt 134  Q
    ||||||||||| ||||||   |||||||| || ||  |||| ||||||||||||||| |||||| ||||||  ||||||||    
T  3540762 caaaatgtttgtgacgaggtgttttgccagtgtttttgcccttggaaaattccctcataaacgttccttttctcagggatt 3540842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 93; Significance: 4e-45; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 36394970 - 36394830
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||||||||||||||||| |||||||||||||||||||||  ||| |||||||||||||||||||| |||| ||| ||||||||||||||||||    
T  36394970 ccctggcaaaatgtttgcgacgagggcttttgccattgcttccgccattgggaaattccctcacaaacgtcctttttcccaaggattctgtccttttgac 36394871  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||| ||||||||||  |||| ||||||||||||| |||||    
T  36394870 aagggttttgcccctgacaaaaggtaatgtttcttgtagtg 36394830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 2062242 - 2062102
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| |||||||||||||| |||||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  2062242 ccctggcaaaaggtttgcgatgagcgcttttgccactgcttccgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 2062143  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||| ||||| ||||| ||||||||||||| |||||    
T  2062142 agggattttacccctggcaaaaggtaatgtttcttgtagtg 2062102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 37566694 - 37566554
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||||||    
T  37566694 ccctggcaaagtgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccgtttgccagggattttgtccttttgac 37566595  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| || |||||||||| |||||    
T  37566594 agggattttgcccctggcaaaaggcaatgtttcttgtagtg 37566554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 33871914 - 33871774
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||  |||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| |||||| || ||||||||||||    
T  33871914 ccctggcaaagcgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccatttgccagggcttttgtccttttgac 33871815  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| || |||||| ||| |||||    
T  33871814 agggattttgcccctggcaaaaggcaatgttccttgtagtg 33871774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 93; Significance: 4e-45; HSPs: 15)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 23705921 - 23706061
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| |||||||||||||| |||||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  23705921 ccctggcaaaaggtttgcgatgagcgcttttgccactgcttccgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 23706020  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  23706021 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 23706061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 23724377 - 23724517
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| |||||||||||||| |||||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  23724377 ccctggcaaaaggtttgcgatgagcgcttttgccactgcttccgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 23724476  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  23724477 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 23724517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 23742833 - 23742973
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| |||||||||||||| |||||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  23742833 ccctggcaaaaggtttgcgatgagcgcttttgccactgcttccgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 23742932  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| ||||||||||||| |||||    
T  23742933 agggattttgcccctggcaaaaggtaatgtttcttgtagtg 23742973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 18553201 - 18553061
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| |||||||||||||| |||||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  18553201 ccctggcaaaaggtttgcgatgagcgcttttgccactgcttccgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 18553102  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| |||||| |||||| |||||    
T  18553101 agggattttgcccctggcaaaaggtaatatttcttgtagtg 18553061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 15858842 - 15858982
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| |||||||||||||| |||||||||||||||    ||| |||||||||||||||||| ||||||||| ||||||||||||    
T  15858842 ccctggcaaaaggtttgcgatgagcgcttttgccactgcttccgcccctggctttttctctcacaaacgtcccttttgccagggattttgtccttttgac 15858941  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||| |||| ||||| ||||||||||||| |||||    
T  15858942 aaggattttgtccctggcaaaaggtaatgtttcttgtagtg 15858982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 48 - 178
Target Start/End: Complemental strand, 29723283 - 29723153
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| ||||||||||||||||||||||||||||| | ||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||  |    
T  29723283 ccctgacaaaatgtttgcgacgagcgcttttgccagtacttccgcccctggtaaattccctcgcaaacgtcccttttcccagggattctgtccttttctc 29723184  T
Q  148 aaggattttgcccctagcaaatggtaatgtt 178  Q
    | ||| ||||||||| ||||| |||||||||    
T  29723183 agggagtttgcccctggcaaaaggtaatgtt 29723153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 6580706 - 6580846
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||| |||||||||||||||||||||||||||| | |||| |||||||  |||||||||||||||||||||||||  ||||||||||||||||||  |    
T  6580706 ccctggtaaaatgtttgcgacgagcgcttttgccaatacttctgcccctgacaaattccctcacaaacgtcccttttctcagggattctgtccttttccc 6580805  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | |||||||||| || ||||| || |||||||||| |||||    
T  6580806 agggattttgccgctggcaaaaggcaatgtttcttgtagtg 6580846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 57 - 188
Target Start/End: Original strand, 47167400 - 47167531
Alignment:
Q  57 aatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggatttt 156  Q
    |||||||| ||||||||||||||| | | ||||||||||||| |||||||||||||||| |||||||| ||| |||||||||||||||  || |||||||    
T  47167400 aatgtttgtgacgagcgcttttgctagtacttccgcccctggcaaattccctcacaaacatcccttttcccaaggattctgtccttttctcagggatttt 47167499  T
Q  157 gcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||| | ||||| ||||||||||||| |||||    
T  47167500 gcccatggcaaaaggtaatgtttcttgtagtg 47167531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 52 - 188
Target Start/End: Original strand, 20858885 - 20859021
Alignment:
Q  52 ggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaagg 151  Q
    |||||||  ||||||| || |||||||||||||||||| |||||||     ||||||||||||||||| |||| ||||||||| ||| ||||||||| ||    
T  20858885 ggcaaaacttttgcgatgaacgcttttgccattgcttctgcccctgactttttccctcacaaacgtccattttgccagggattatgtacttttgacaggg 20858984  T
Q  152 attttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    ||||||||||| ||||| ||||||||||||| |||||    
T  20858985 attttgcccctggcaaaaggtaatgtttcttgtagtg 20859021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 48 - 200
Target Start/End: Original strand, 32928098 - 32928251
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| |||||||||||||| ||| |||||||| |||||||| |||||||| |  |||||||||||| ||| | ||| ||||||||| | ||||||||||    
T  32928098 ccctgacaaaatgtttgcgatgagtgcttttgcgattgcttctgcccctggcattttccctcacaaatgtcgcgtttcccagggattgtatccttttgac 32928197  T
Q  148 aaggattttgcccctagc-aaatggtaatgtttcttctagtggattgggatgat 200  Q
    | ||||||| ||||| || ||| ||||||||||||| ||||| |||| ||||||    
T  32928198 agggattttacccctggcaaaaaggtaatgtttcttgtagtgtattgagatgat 32928251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 33900869 - 33900729
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||||||    
T  33900869 ccctggcaaagtgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccgtttgccagggattttgtccttttgac 33900770  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| || |||||| ||| |||||    
T  33900769 agggattttgcccctggcaaaaggcaatgttccttgtagtg 33900729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 51 - 157
Target Start/End: Original strand, 985382 - 985488
Alignment:
Q  51 tggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaag 150  Q
    ||||||||||||  | |||| ||||||||| | ||||||||||||||| ||||||||||||||||||||| ||| | ||||||||||| |||||  |||     
T  985382 tggcaaaatgttaacaacgaacgcttttgcgagtgcttccgcccctgggaaattccctcacaaacgtcccgtttgctagggattctgttcttttctcaaa 985481  T
Q  151 gattttg 157  Q
    |||||||    
T  985482 gattttg 985488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 103 - 188
Target Start/End: Original strand, 26250115 - 26250200
Alignment:
Q  103 ttccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    |||||||||||| ||||| ||| ||||||||| ||||||||||||| ||||||||||||| ||||| || |||||||||| |||||    
T  26250115 ttccctcacaaatgtcccgtttgccagggattttgtccttttgacagggattttgcccctggcaaaaggcaatgtttcttgtagtg 26250200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 57 - 124
Target Start/End: Original strand, 46831795 - 46831862
Alignment:
Q  57 aatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttt 124  Q
    |||||||||||||||   |||||| | || |||||||||| | |||||||||||||||||||||||||    
T  46831795 aatgtttgcgacgaggtgttttgcgagtgtttccgcccctagcaaattccctcacaaacgtccctttt 46831862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 111 - 188
Target Start/End: Original strand, 889322 - 889399
Alignment:
Q  111 caaacgtccctttttccagggattctgtccttttgacaaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    ||||||||  |||| ||||||||| |||||||||   | ||||||| ||||||||||| | ||||||||||| |||||    
T  889322 caaacgtctattttcccagggattatgtccttttcttagggattttacccctagcaaaagataatgtttcttgtagtg 889399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0573 (Bit Score: 89; Significance: 9e-43; HSPs: 1)
Name: scaffold0573
Description:

Target: scaffold0573; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 48 - 180
Target Start/End: Complemental strand, 5506 - 5374
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||| |||||||| |||||||||||||| |||||||||||||||    |||||||||||||||||||||| ||||||||||||||||||||||    
T  5506 ccctggcaaaaggtttgcgatgagcgcttttgccactgcttccgcccctggctttttccctcacaaacgtcccttttgccagggattctgtccttttgac 5407  T
Q  148 aaggattttgcccctagcaaatggtaatgtttc 180  Q
    | ||||||||||||| ||||| |||||||||||    
T  5406 agggattttgcccctggcaaaaggtaatgtttc 5374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 80; Significance: 2e-37; HSPs: 7)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 48 - 187
Target Start/End: Original strand, 26979677 - 26979816
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||||||| |||||||||| |||||||| ||||||||||| ||| |||||||||||||||||||  |||||||||||||||| |||||||  |    
T  26979677 ccctggcaaaatgttagcgacgagcggttttgccagtgcttccgcccttggtaaattccctcacaaacgtctatttttccagggattctatccttttctc 26979776  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagt 187  Q
    | |||||||||||||  |||| ||||||||||||| ||||    
T  26979777 agggattttgcccctgacaaaaggtaatgtttcttgtagt 26979816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 44409352 - 44409492
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| |||||||||||| ||||||||||||||||   ||| ||||||||| |||||||||||||||||||||||||   |||||||||||||||||  |    
T  44409352 ccctgacaaaatgtttgcaacgagcgcttttgccagccctttcgcccctggcaaattccctcacaaacgtcccttttcatagggattctgtccttttctc 44409451  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||| |||||  |||| |||||| |||||| |||||    
T  44409452 agggattttacccctgacaaaaggtaatatttcttgtagtg 44409492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 54 - 187
Target Start/End: Complemental strand, 45876784 - 45876651
Alignment:
Q  54 caaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgacaaggat 153  Q
    |||||||||||||| ||| || ||||| ||||||||  ||||||| |  |||||||||||| ||| | ||||||| ||||| ||||||||||||| ||||    
T  45876784 caaaatgtttgcgatgagtgcctttgcgattgcttctacccctggcattttccctcacaaatgtcgcattttccaaggattgtgtccttttgacagggat 45876685  T
Q  154 tttgcccctagcaaatggtaatgtttcttctagt 187  Q
    |||||||||  |||| ||||||||||||| ||||    
T  45876684 tttgcccctgacaaaaggtaatgtttcttgtagt 45876651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 2397806 - 2397666
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||||||||||||| ||||||||||||||   | || |||||| |    | |||||||||| ||||| ||| ||||||||| |||||||||||     
T  2397806 ccctggcaaaatgtttgcgatgagcgcttttgccaggccatctgcccctcgtttttcccctcacaaatgtcccgtttgccagggattttgtccttttgat 2397707  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| || |||||||||| |||||    
T  2397706 agggattttgcccctggcaaaaggcaatgtttcttgtagtg 2397666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 48 - 188
Target Start/End: Complemental strand, 20337283 - 20337143
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||||||    
T  20337283 ccctggcaaagtgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccgtttgccagggattttgtccttttgac 20337184  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | |||||| |||||| ||||| || |||||||||| |||||    
T  20337183 agggatttcgcccctggcaaaaggcaatgtttcttgtagtg 20337143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 48 - 187
Target Start/End: Complemental strand, 1859686 - 1859548
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||| |||| ||||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||||||    
T  1859686 ccctgacaaagtgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccgtttgccagggattttgtccttttgac 1859587  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagt 187  Q
    | |||||||| |||| ||||| || |||||||||| ||||    
T  1859586 agggattttg-ccctggcaaaaggcaatgtttcttgtagt 1859548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 103 - 188
Target Start/End: Complemental strand, 49326214 - 49326128
Alignment:
Q  103 ttccctcacaaacgtccctttttccagggattctgtccttttgacaaggattttgcccctag-caaatggtaatgtttcttctagtg 188  Q
    |||||||||||| ||||||||| | ||| ||| ||||||||||||| ||||||||||||| | |||| | ||||||||||| |||||    
T  49326214 ttccctcacaaatgtcccttttccgaggaattatgtccttttgacagggattttgccccttgacaaaagataatgtttcttgtagtg 49326128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0669 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: scaffold0669
Description:

Target: scaffold0669; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 48 - 189
Target Start/End: Complemental strand, 5407 - 5266
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    |||||||||| ||||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||||||    
T  5407 ccctggcaaagtgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccgtttgccagggattttgtccttttgac 5308  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtgg 189  Q
    | ||||||||||||| ||||| || |||||||||| ||||||    
T  5307 agggattttgcccctggcaaaaggcaatgtttcttgtagtgg 5266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0164 (Bit Score: 53; Significance: 3e-21; HSPs: 1)
Name: scaffold0164
Description:

Target: scaffold0164; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 48 - 188
Target Start/End: Original strand, 971 - 1111
Alignment:
Q  48 ccctggcaaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtccttttgac 147  Q
    ||||||||||  |||||||| ||||||||||||||   | || |||||| |    |||||||||||| ||||| ||| ||||||||| ||||||||||||    
T  971 ccctggcaaagcgtttgcgatgagcgcttttgccaggccatctgcccctcgttttttccctcacaaatgtcccatttgccagggattttgtccttttgac 1070  T
Q  148 aaggattttgcccctagcaaatggtaatgtttcttctagtg 188  Q
    | ||||||||||||| ||||| || |||||||||| |||||    
T  1071 agggattttgcccctggcaaaaggcaatgtttcttgtagtg 1111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 54 - 140
Target Start/End: Complemental strand, 92517 - 92431
Alignment:
Q  54 caaaatgtttgcgacgagcgcttttgccattgcttccgcccctggaaaattccctcacaaacgtccctttttccagggattctgtcc 140  Q
    ||||||||||||||||||   |||||| | || |||||||||||| |||||||||||||||||||||||||  |||||||| |||||    
T  92517 caaaatgtttgcgacgaggtgttttgcgaatgtttccgcccctggcaaattccctcacaaacgtcccttttctcagggattttgtcc 92431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University