View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7455_low_5 (Length: 307)
Name: NF7455_low_5
Description: NF7455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7455_low_5 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 136 - 307
Target Start/End: Complemental strand, 14108271 - 14108099
Alignment:
| Q |
136 |
aaacgtgtttatttatcatagtgtatgatttgcttcaaagcgagtatttctactataatat--gcttccnnnnnnnnntctccaggacgtcacttgaatt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
14108271 |
aaacgtgtttatttatcatagtgtatgatttgcttcaaagcgagtatttctactataatatatgcttccaaaaaaaa-tctccaggacgtcacttgaatt |
14108173 |
T |
 |
| Q |
234 |
tctttgttggagtttcctacaaaatgatcactttgttcttcgggccaagcattgactttggttttcatggtctt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14108172 |
tctttgttggagtttcctacaaaatgatcactttgttcttcgggacaagcattgactttggttttcatggtctt |
14108099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University