View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7455_low_7 (Length: 264)
Name: NF7455_low_7
Description: NF7455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7455_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 7 - 248
Target Start/End: Original strand, 301863 - 302104
Alignment:
| Q |
7 |
tttggtgttggctatttagttctgtcaatttctaccgcaatgttgtctttgtttaattctattctggtgagatatagttttcttgggaagctattctctt |
106 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
301863 |
tttggtgttggttatttagttctgtcaatttctaccgcaatgttgtctttgtttaattctattctggtgagatatagttttctttggaagctattctctt |
301962 |
T |
 |
| Q |
107 |
atgtatgtttttatacggttaactgttatctcatttctcattcttttaggcagaaacatgagccgaactgttatttttaatatttttacctaatcgcagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
301963 |
atgtatgtttttatacggttaactgttatctcatttctcattcttttaggcagaaacatgagccgaactgttatttttaatatttttacctaatcgcagg |
302062 |
T |
 |
| Q |
207 |
catttgatcgagacatgtgaaaaatattgtatccatattctg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
302063 |
catttgatcgagacatgtgaaaaatattgtatccatattctg |
302104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 58
Target Start/End: Complemental strand, 27464527 - 27464479
Alignment:
| Q |
11 |
gtgttggctatttagttctgt-caatttctaccgcaatgttgtctttgt |
58 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||||||||| ||||||||| |
|
|
| T |
27464527 |
gtgttggttatttagttctgtacaacttctaccgcaatgctgtctttgt |
27464479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University