View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7455_low_8 (Length: 257)
Name: NF7455_low_8
Description: NF7455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7455_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 928672 - 928437
Alignment:
| Q |
1 |
ctgcattgagtttcataaaatcagtaaaaagcaatgtaagatggaaacaaattaagataatttatgtatctgagatataaataacccattaattagtatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
928672 |
ctgcattgagtttcataaaatcagtaaaaagcaatgtaagatggaaacaaattaagataatttatgtatctgagatataaataacccattaattagtatc |
928573 |
T |
|
| Q |
101 |
ataagttattaatacacacatttcatttat---tatttgcctaggaggcaccaaaggagttttaagcatgaggtttggagttcaaactctaaaaacctat |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
928572 |
ataagttattaatacacacatttcatttattattatttgcctaggaggcaccaaaggagttttaagcatgaggtttggagttcaaactctaaaaacctat |
928473 |
T |
|
| Q |
198 |
gcaacaccgagacttcaggttgaaagtgtctagtgt |
233 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
928472 |
gcaataccgagacttcaggttgaaagtgtctagtgt |
928437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University