View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7456_low_13 (Length: 239)
Name: NF7456_low_13
Description: NF7456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7456_low_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 3423223 - 3423445
Alignment:
| Q |
18 |
aataaataataagtttaaaagaaaaaacatgtcattctattattcaattcaaaccnnnnnnnccttagaaaatttattcaattcaaactcaagtgtctta |
117 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3423223 |
aataaataataagataaaaagaaaaaacatgtcattctattattcaattcaaacctttttttccttagaaaatttattcaattcaaactcaagtgtctta |
3423322 |
T |
 |
| Q |
118 |
cattatt-acttatctggttttaaggtcagtatgttttttaccttcacgttatacataatgaaattttaacttccatggaagctatatcatggatcgaat |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3423323 |
cattatttacttatctggttttaaggtcagtatgttttttaccttcacgttatacataatgaaattttaacttccatgaaagctatatcatggatcgaat |
3423422 |
T |
 |
| Q |
217 |
gctagtgctagataaaattgcat |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3423423 |
gctagtgctagataaaattgcat |
3423445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University