View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7456_low_17 (Length: 203)
Name: NF7456_low_17
Description: NF7456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7456_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 43 - 190
Target Start/End: Complemental strand, 46667604 - 46667458
Alignment:
| Q |
43 |
ttatgatagattaaatttaattcatttttattgaatttctatgaacaaacaaataataaactttcgataatatttacctcttgtcgctctataaagccat |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46667604 |
ttatgatagattaaatttaattcatttttattgaatttctatgaacaaacaaataataa-ctttcaataatatttacctcttgtcgctctataaagccat |
46667506 |
T |
|
| Q |
143 |
tatcattcaagtcaaagagcctaaatgaaactgcatcacaacaccaaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
46667505 |
tatcattcaagtcaaagagcctaaatgaaactgcatcacaataccaaa |
46667458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University