View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7456_low_5 (Length: 351)
Name: NF7456_low_5
Description: NF7456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7456_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 16 - 333
Target Start/End: Original strand, 29718141 - 29718456
Alignment:
| Q |
16 |
acatcatggccgaggagaaattgttccaacagcaaatggttaccgccatcaatgggttggtgatgctgagcactctcttcaccgtggtgactatcatact |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
29718141 |
acattatggccgaggagaaattgttccaacagcaaatggttaccgccatcaatgggttggtgatgctgagcaccctcttcaccgtggtgactatcatact |
29718240 |
T |
|
| Q |
116 |
tatgagcagcttcatgattgcatcctcacaaccaccatcgccaccaacaacagcgaaatggtacactatgttattcatgatgtgttatcattttgctgtt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29718241 |
tatgagcagcttcatgattgcatcctcacaaccaccatcgccaccaacaacagcgaaatggtacactatgttattcatg--gtgttatcattttgctgtt |
29718338 |
T |
|
| Q |
216 |
ttgttttaatgacggtcttgtctcttatcataaagcaaggattgatcatgcacaactacacgaacaaggttagaagctgctccgtgcttggaataagcgc |
315 |
Q |
| |
|
||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29718339 |
ttgttttcacgacggtattgtctcttatcataaagcaaggattgatcatgcacaactacacgaacaaggttagaagctgctccgtgtttggaataagcgc |
29718438 |
T |
|
| Q |
316 |
gattctgtgtgccggtct |
333 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
29718439 |
gattctgtgtgccagtct |
29718456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University