View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7457_high_17 (Length: 291)
Name: NF7457_high_17
Description: NF7457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7457_high_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 13 - 291
Target Start/End: Complemental strand, 2766190 - 2765912
Alignment:
| Q |
13 |
aatatcaccttctcttagcatgcaagtaatttcatcgtcgttcataccttccaatccaagcaatgcagagtttttctttaagctctcaaatgttatcact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2766190 |
aatatcaccttctcttagcatgcaagtaatttcatcgtcgttcataccttccaatccaagcaatgcagagtttttctttaagctctcaaatgttatcact |
2766091 |
T |
 |
| Q |
113 |
ttcttctccctgtccatcaacacattaaaaccatttgccaactccttcataaacccttcacttcctaatttctccatcattgaagggaagtagtcctcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2766090 |
ttcttctccctgtccatcaacacattaaaaccatttgccaactccttcataaacccttcacttcctaatttctccatcattgaagggaagtagtcctcaa |
2765991 |
T |
 |
| Q |
213 |
aaacaaccgatccaccattcttcctcgaactcgatgccatttttgctcaattttgtgaagttgtaatacaaacaaaata |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2765990 |
aaacaaccgatccaccattcttcctcgaactcgatgccatttttgctcaattttgtgaagttgtaatataaacaaaata |
2765912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University