View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7457_high_20 (Length: 257)
Name: NF7457_high_20
Description: NF7457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7457_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 99
Target Start/End: Complemental strand, 20597514 - 20597432
Alignment:
| Q |
17 |
tgttgggtaacacaccatccttcaacattgcagctttctgcctgtttgcttcccatctctccatcaagtacactctgatgtcc |
99 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
20597514 |
tgttgggtaacacaccatcctccaacattgcagctttctgcctgtttgcttcccatctctccatcaggtacactctgatgtcc |
20597432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 17 - 96
Target Start/End: Complemental strand, 8698514 - 8698435
Alignment:
| Q |
17 |
tgttgggtaacacaccatccttcaacattgcagctttctgcctgtttgcttcccatctctccatcaagtacactctgatg |
96 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
8698514 |
tgttgggtaacacaccatcctccaacattgcagctttctgcctgtttgcttcccatctctccatcaggtacactctgatg |
8698435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 143 - 204
Target Start/End: Original strand, 20410534 - 20410595
Alignment:
| Q |
143 |
gatatggtgacagagacatacacaatgttgcttccacctaaaggttttgattatagaactcc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
20410534 |
gatatggtgacagagacatacacaatgttgcttccacatcaaggttttgattatagaactcc |
20410595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 20452698 - 20452747
Alignment:
| Q |
155 |
gagacatacacaatgttgcttccacctaaaggttttgattatagaactcc |
204 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
20452698 |
gagacatacacaatgttgcttccacatcaaggttttgattatagaactcc |
20452747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 51 - 92
Target Start/End: Original strand, 37101837 - 37101878
Alignment:
| Q |
51 |
tttctgcctgtttgcttcccatctctccatcaagtacactct |
92 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
37101837 |
tttctgcctatttgcttcccatctctccatcaggtacactct |
37101878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University