View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7457_high_26 (Length: 227)
Name: NF7457_high_26
Description: NF7457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7457_high_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 2451281 - 2451492
Alignment:
| Q |
1 |
tatttaattttcatcatgatgtcttgaaattgtggtgtctannnnnnnnnnnnncaaaattgttttgtttatttaaatgcgtagttttgttggtttatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2451281 |
tatttaattttcatcatgatgtcttgaaattgtgttgtctatttttctttttttcaaaattgttttgtttatttaaatgcttagttttgttggtttatat |
2451380 |
T |
|
| Q |
101 |
aaatacgttggcttattggtacatttagaattatgcttgttaaaccttggtttatataagccatgctaacgctaactcaagaccaaaatttccctgcaac |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2451381 |
aaatacgctggcttattggtacatttagaattatgcttgctaaaccttggtttatataagccatgctaacgctaactcaagaccaaaatttccctgcaac |
2451480 |
T |
|
| Q |
201 |
ttgccgaacaca |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2451481 |
ttgccgaacaca |
2451492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 59 - 118
Target Start/End: Original strand, 2462366 - 2462425
Alignment:
| Q |
59 |
attgttttgtttatttaaatgcgtagttttgttggtttatataaatacgttggcttattg |
118 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2462366 |
attgttttgtttacttaaaagcttagttttgttggtttatataaatactttggcttattg |
2462425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University