View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7457_low_22 (Length: 257)

Name: NF7457_low_22
Description: NF7457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7457_low_22
NF7457_low_22
[»] chr3 (1 HSPs)
chr3 (17-99)||(20597432-20597514)
[»] chr6 (1 HSPs)
chr6 (17-96)||(8698435-8698514)
[»] chr7 (2 HSPs)
chr7 (143-204)||(20410534-20410595)
chr7 (155-204)||(20452698-20452747)
[»] chr4 (1 HSPs)
chr4 (51-92)||(37101837-37101878)


Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 17 - 99
Target Start/End: Complemental strand, 20597514 - 20597432
Alignment:
17 tgttgggtaacacaccatccttcaacattgcagctttctgcctgtttgcttcccatctctccatcaagtacactctgatgtcc 99  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
20597514 tgttgggtaacacaccatcctccaacattgcagctttctgcctgtttgcttcccatctctccatcaggtacactctgatgtcc 20597432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 17 - 96
Target Start/End: Complemental strand, 8698514 - 8698435
Alignment:
17 tgttgggtaacacaccatccttcaacattgcagctttctgcctgtttgcttcccatctctccatcaagtacactctgatg 96  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
8698514 tgttgggtaacacaccatcctccaacattgcagctttctgcctgtttgcttcccatctctccatcaggtacactctgatg 8698435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 143 - 204
Target Start/End: Original strand, 20410534 - 20410595
Alignment:
143 gatatggtgacagagacatacacaatgttgcttccacctaaaggttttgattatagaactcc 204  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||    
20410534 gatatggtgacagagacatacacaatgttgcttccacatcaaggttttgattatagaactcc 20410595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 155 - 204
Target Start/End: Original strand, 20452698 - 20452747
Alignment:
155 gagacatacacaatgttgcttccacctaaaggttttgattatagaactcc 204  Q
    ||||||||||||||||||||||||| | ||||||||||||||||||||||    
20452698 gagacatacacaatgttgcttccacatcaaggttttgattatagaactcc 20452747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 51 - 92
Target Start/End: Original strand, 37101837 - 37101878
Alignment:
51 tttctgcctgtttgcttcccatctctccatcaagtacactct 92  Q
    ||||||||| |||||||||||||||||||||| |||||||||    
37101837 tttctgcctatttgcttcccatctctccatcaggtacactct 37101878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University