View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7457_low_26 (Length: 239)
Name: NF7457_low_26
Description: NF7457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7457_low_26 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 48915568 - 48915485
Alignment:
| Q |
1 |
agatttaaaattaaaatcacagccatgccctcttccaatttacacccctcttcctttcatgcgagattcacgtttctctcctct |
84 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
48915568 |
agatttaaaattaaaatcagagtcatgccctcttccaatttacacccctcttcctttcatccgagattcacgtttctcccctct |
48915485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 6 - 95
Target Start/End: Original strand, 30552216 - 30552304
Alignment:
| Q |
6 |
taaaattaaaatcacag-ccatgccctcttccaatttacacccctcttcctttcatgcgagattcacgtttctctcctctcttatgttggc |
95 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| | ||||||||| |||||| ||||||| ||||||| |
|
|
| T |
30552216 |
taaaattaaaatcacagaccatgccctcttccaatttacacccgtcttcctttcat-ccagattcacg-ttctcttctctcttctgttggc |
30552304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 11 - 57
Target Start/End: Complemental strand, 48923088 - 48923042
Alignment:
| Q |
11 |
ttaaaatcacagccatgccctcttccaatttacacccctcttccttt |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48923088 |
ttaaaatcacagccatgccctcttccaatttacacccctcttccttt |
48923042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University