View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7458_low_10 (Length: 225)
Name: NF7458_low_10
Description: NF7458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7458_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 30771902 - 30772087
Alignment:
| Q |
19 |
atattgacacaagaccaatttggcattaacactatatagctcggccataggttttgactcaaaaaaggtgaaaggtatggtttaatggttacttctagtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30771902 |
atattgacacaagaccaatttggcattaacactatatatgtcggccataggttttgactcaaaaaaggtgaaaggtatggtttaatggttacttctagtt |
30772001 |
T |
|
| Q |
119 |
ccacatattgaacaataatctttcacaatctctttacggctaattttctgtttactcctcttgcattttcggtttgcctgtatgga |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30772002 |
ccacatattgaacaataatctttcacaatatctttacggctaattttctgtttactcctcttgcattttcggtttgcctgtatgga |
30772087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University