View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7458_low_12 (Length: 204)
Name: NF7458_low_12
Description: NF7458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7458_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 4e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 14 - 184
Target Start/End: Original strand, 3643095 - 3643265
Alignment:
| Q |
14 |
atattattctaagagacacaacagtgggactcaaaaggaatgaatgaacccaaagatgaatgatataataatcatgaatatcatgaatttaatatttggc |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3643095 |
atataattctaagagacacaacagtgggactcaaaaggaatgaatgaacccaaagatgaatgatataataatcatgaatatcatgaatttaatatttggc |
3643194 |
T |
 |
| Q |
114 |
aattcataagttgttgttggtttcatgacggtctatgtgtgtatttatttactttgatcgatgataatgtt |
184 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
3643195 |
aattcataagttgttattggtttcatgacggcctatgtgtgtatttattttctttgattgatgataatgtt |
3643265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 33987717 - 33987770
Alignment:
| Q |
30 |
cacaacagtgggactcaaaaggaatgaatgaacccaaagatgaatgatataata |
83 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||| |||||||||| ||||||||| |
|
|
| T |
33987717 |
cacaactgtggcactcaaaacaaatgaatgaacacaaagatgaaagatataata |
33987770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University