View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7459_low_10 (Length: 263)
Name: NF7459_low_10
Description: NF7459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7459_low_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 165 - 245
Target Start/End: Complemental strand, 7911473 - 7911393
Alignment:
| Q |
165 |
aaataatttatgtattatcaatcactcaatgtaagttgtaagtacagtgaataaaattttgattttcgtatcctttacatg |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7911473 |
aaataatttatgtattatcaatcactcaatgtaagttgtaagtacagtgaataaaattttgattttcgtatcctttacatg |
7911393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University