View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7459_low_11 (Length: 227)

Name: NF7459_low_11
Description: NF7459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7459_low_11
NF7459_low_11
[»] chr1 (1 HSPs)
chr1 (23-130)||(48626032-48626139)


Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 23 - 130
Target Start/End: Original strand, 48626032 - 48626139
Alignment:
23 catccaagtatttctagtctagaaaatgttcactttactgtgatacatgtctaagttgcagtgactcaatgtcatccatttacacgttcatgtctctcaa 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48626032 catccaagtatttctagtctagaaaatgttcactttactgtgatacatgtctaagttgcagtgactcaatgtcatccatttacacgttcatgtctctcaa 48626131  T
123 caatggtg 130  Q
    ||||||||    
48626132 caatggtg 48626139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University