View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7459_low_11 (Length: 227)
Name: NF7459_low_11
Description: NF7459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7459_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 23 - 130
Target Start/End: Original strand, 48626032 - 48626139
Alignment:
| Q |
23 |
catccaagtatttctagtctagaaaatgttcactttactgtgatacatgtctaagttgcagtgactcaatgtcatccatttacacgttcatgtctctcaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48626032 |
catccaagtatttctagtctagaaaatgttcactttactgtgatacatgtctaagttgcagtgactcaatgtcatccatttacacgttcatgtctctcaa |
48626131 |
T |
 |
| Q |
123 |
caatggtg |
130 |
Q |
| |
|
|||||||| |
|
|
| T |
48626132 |
caatggtg |
48626139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University