View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7460_low_15 (Length: 232)
Name: NF7460_low_15
Description: NF7460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7460_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 17 - 215
Target Start/End: Complemental strand, 48277150 - 48276946
Alignment:
| Q |
17 |
cccgtttgtctcttcgaaatcttgtttgctttccatttccat------caccaatggtcttccctcataggcagccatgttgttttttaagttgtgagtt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277150 |
cccgtttgtctcttcgaaatcttgtttgctttccatttccatttccatcaccaatggtcttccctcataggcagccatgttgttttttaagttgtgagtt |
48277051 |
T |
|
| Q |
111 |
aatagaggttttgatcattgagaaagcatatatagggtgatagaaggaaaggaagaaaagtcaaagaaaccgtatgacaaatttgaattttcaatatata |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48277050 |
aatagaggatttgatcattgagaaagcatatatatggtgatagaaggaaaggaagaaaagtcaaagaaaccgtatgacaaatttgaattttcaatatata |
48276951 |
T |
|
| Q |
211 |
tatgg |
215 |
Q |
| |
|
||||| |
|
|
| T |
48276950 |
tatgg |
48276946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University