View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7460_low_17 (Length: 202)
Name: NF7460_low_17
Description: NF7460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7460_low_17 |
 | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 57 - 183
Target Start/End: Original strand, 27432901 - 27433027
Alignment:
| Q |
57 |
ccatgcagataagctatacgtagaatttcatgatgaatgctggggagttccagcttatgacgacaagtaagtactaattaccgttcaacagttgtaatgt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27432901 |
ccatgcagataagctatacgtagaatttcatgatgaatgctggggagttccagcttatgacgacaagtaagtactaattaccgttcaacagttgtaatgt |
27433000 |
T |
|
| Q |
157 |
tataataattaatatgtaatttttggt |
183 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
27433001 |
tataataattaatatgtaatttttggt |
27433027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 60 - 127
Target Start/End: Complemental strand, 103502 - 103435
Alignment:
| Q |
60 |
tgcagataagctatacgtagaatttcatgatgaatgctggggagttccagcttatgacgacaagtaag |
127 |
Q |
| |
|
|||||||||| |||| ||||||||||||| ||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
103502 |
tgcagataaggcatacatagaatttcatgacgaatgttggggagttccagcttatgatgacaagtaag |
103435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University