View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_1D_low_21 (Length: 234)
Name: NF7461_1D_low_21
Description: NF7461_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_1D_low_21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 22 - 234
Target Start/End: Complemental strand, 36950063 - 36949854
Alignment:
| Q |
22 |
gcacgatgagcagcagccatttataaatgggttcactgacacagtgaacactatttcggtggcagaacaatatatgttacatggaatgcctagtagatca |
121 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36950063 |
gcacgatgagcagcagccatttataaacgggttcactgacacagtgaacactatttcggtggcagaaccatatatgttacatggaatgcctagtagatca |
36949964 |
T |
|
| Q |
122 |
gatatgcagcagcttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgcccccttggattgttgcatatattttgcttgaaaag |
221 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36949963 |
catatgcacc---ttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgcccccttggtttgttgcatatattttgcttgaaaag |
36949867 |
T |
|
| Q |
222 |
gattcttaagtgt |
234 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36949866 |
gattcttaagtgt |
36949854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 105 - 211
Target Start/End: Original strand, 10818104 - 10818210
Alignment:
| Q |
105 |
gaatgcctagtagatcagatatgcagcagcttattaatgtcaatagacacatggtatgttttttctcccttcccatctatgcccccttggattgttgcat |
204 |
Q |
| |
|
||||||||||||||||| ||||||| | | |||||||| |||||||||||||||||| |||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
10818104 |
gaatgcctagtagatcacatatgcaacgtgacaataatgtcactagacacatggtatgtttattctcccttctcatctttgcccccttcgattgttgcat |
10818203 |
T |
|
| Q |
205 |
atatttt |
211 |
Q |
| |
|
||||||| |
|
|
| T |
10818204 |
atatttt |
10818210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University