View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_1D_low_25 (Length: 228)
Name: NF7461_1D_low_25
Description: NF7461_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_1D_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 24 - 212
Target Start/End: Original strand, 21625626 - 21625815
Alignment:
| Q |
24 |
aatatgtgcttattttgcttattttcttgttccaattctatgtatcatctttttaattaatttccaccttgcttttgttatccaaatatattgattttcc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21625626 |
aatatgtgcttattttgcttattttcttgttccaattctatgtatcatctttttgattaatttacaccttgcttttgttatccaaatatattgattttcc |
21625725 |
T |
 |
| Q |
124 |
attc-nnnnnnnnnnatttgtgtgtgattcatttatgttccaagtgggaagtaacttgtgctgttgtgtttgcttttttattttgatgtc |
212 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21625726 |
attctttttttttttatttgtgtgtgattcatttatgttccaagtgggaagtaacttgtgttgttgtgtttgcttttttattttgatgtc |
21625815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University