View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_2D_high_14 (Length: 221)
Name: NF7461_2D_high_14
Description: NF7461_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_2D_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 100 - 198
Target Start/End: Original strand, 24743527 - 24743624
Alignment:
| Q |
100 |
gcgtctttagttagtcattttaattgtcaaatgtgtttttcttactataatgacaacgcgtctgacacattcagagatcaaaatgactacttttctttt |
198 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
24743527 |
gcgtctttggttagtcattttaatcgtcaaatgtgtttctcttacgataatgacaacgcgtctgacacattcagagattaaaatgacta-ttttctttt |
24743624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 24743463 - 24743499
Alignment:
| Q |
1 |
aatcccaaatccaagagt-aacaaccattttagtccc |
36 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24743463 |
aatcccaaatccaagagtaaacaaccattttagtccc |
24743499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University