View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7461_2D_high_18 (Length: 210)

Name: NF7461_2D_high_18
Description: NF7461_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7461_2D_high_18
NF7461_2D_high_18
[»] chr6 (1 HSPs)
chr6 (1-194)||(10523390-10523584)


Alignment Details
Target: chr6 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 10523390 - 10523584
Alignment:
1 cttggctttttatctttcatacatatgggatgtttaaagtaactgataactggatttggttacctttgtttggatacaatcacaaatattgtgcaagcat 100  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
10523390 cttggctttttatctttcatacttatgggatgtttaaagtaactgataactggatttggttacctttgtttggatacaatcacaaatattgtgcatgcat 10523489  T
101 tgtttattccgaaaatacatgtttttgtcaccacttagatttaccga-gggaagttatatttatcgggttgttgtcgtttgccattgtatgatgt 194  Q
    |||||||||||||||| | ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| ||||||| ||||||    
10523490 tgtttattccgaaaatgcttgtttttgtcaccacttagatttaccgactggaagttatatttatcgggttgttgtcgtttaccattgtctgatgt 10523584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University