View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_2D_low_35 (Length: 212)
Name: NF7461_2D_low_35
Description: NF7461_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_2D_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 47418919 - 47419024
Alignment:
| Q |
1 |
ataatgaaccagttattgtcccggaaaaatggttgtagttaccaccactgcttccatatgtcgatgggaaatgtatatgctgttgttgctgcttattaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47418919 |
ataatgaaccagttattgtcccggaaaaatggctgtagttaccaccactgcttccatatgtcgatgggaaatgtatatgctgttgttgctgcttattaag |
47419018 |
T |
|
| Q |
101 |
gccttg |
106 |
Q |
| |
|
|||||| |
|
|
| T |
47419019 |
gccttg |
47419024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 103 - 192
Target Start/End: Complemental strand, 47418842 - 47418753
Alignment:
| Q |
103 |
cttgggtgtagaacggcagagtacattcaacgattctaagtgaatgcgaggttgatctgtgtcaactgaacatttatctaaattgcatgg |
192 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47418842 |
cttgggtgtaatacggcagagtacattcaacgattctaagtgaatgcgaggttgatctgtgtcaactgaacatttatctaaattgcatgg |
47418753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 16 - 106
Target Start/End: Original strand, 47390574 - 47390664
Alignment:
| Q |
16 |
ttgtcccggaaaaatggttgtagttaccaccactgcttccatatgtcgatgggaaatgtatatgctgttgttgctgcttattaaggccttg |
106 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
47390574 |
ttgtcccggaaaaatggctgtagttaccaccactgcctccatatgtcgatgggaaatgtatatgctgttgttgctgcttatttaggccttg |
47390664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 111
Target Start/End: Original strand, 47407673 - 47407783
Alignment:
| Q |
1 |
ataatgaaccagttattgtcccggaaaaatggttgtagttaccaccactgcttccatatgtcgatgggaaatgtatatgctgttgttgctgcttattaag |
100 |
Q |
| |
|
||||||||||||| ||| |||| ||||| | || |||| ||||||||| || |||||| |||||| ||||||||||| ||||||||||| |||| || |
|
|
| T |
47407673 |
ataatgaaccagtgattttccccaaaaaaggattaaagttgccaccactgatttcatatggcgatggaaaatgtatatgttgttgttgctgattataaaa |
47407772 |
T |
|
| Q |
101 |
gccttgggtgt |
111 |
Q |
| |
|
|||||| |||| |
|
|
| T |
47407773 |
gccttgtgtgt |
47407783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 106
Target Start/End: Original strand, 47421378 - 47421483
Alignment:
| Q |
1 |
ataatgaaccagttattgtcccggaaaaatggttgtagttaccaccactgcttccatatgtcgatgggaaatgtatatgctgttgttgctgcttattaag |
100 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||| |||| | ||||||| || |||||| | |||||||||| ||||| ||||||||||| |||| || |
|
|
| T |
47421378 |
ataatgaaccagtgattgtccccaaaaaagggttaaagttgcaaccactgatttcatatggcaatgggaaatgaatatgttgttgttgctgattataaaa |
47421477 |
T |
|
| Q |
101 |
gccttg |
106 |
Q |
| |
|
|||||| |
|
|
| T |
47421478 |
gccttg |
47421483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 103 - 159
Target Start/End: Complemental strand, 47407596 - 47407540
Alignment:
| Q |
103 |
cttgggtgtagaacggcagagtacattcaacgattctaagtgaatgcgaggttgatc |
159 |
Q |
| |
|
|||||||||||||| ||||||| |||||| ||| ||||| ||||||||||| |||| |
|
|
| T |
47407596 |
cttgggtgtagaacagcagagtttattcaatgatcctaagagaatgcgaggtggatc |
47407540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University