View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_2D_low_39 (Length: 210)
Name: NF7461_2D_low_39
Description: NF7461_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_2D_low_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 10523390 - 10523584
Alignment:
| Q |
1 |
cttggctttttatctttcatacatatgggatgtttaaagtaactgataactggatttggttacctttgtttggatacaatcacaaatattgtgcaagcat |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10523390 |
cttggctttttatctttcatacttatgggatgtttaaagtaactgataactggatttggttacctttgtttggatacaatcacaaatattgtgcatgcat |
10523489 |
T |
 |
| Q |
101 |
tgtttattccgaaaatacatgtttttgtcaccacttagatttaccga-gggaagttatatttatcgggttgttgtcgtttgccattgtatgatgt |
194 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
10523490 |
tgtttattccgaaaatgcttgtttttgtcaccacttagatttaccgactggaagttatatttatcgggttgttgtcgtttaccattgtctgatgt |
10523584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University