View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7461_high_21 (Length: 270)
Name: NF7461_high_21
Description: NF7461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7461_high_21 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 10 - 270
Target Start/End: Original strand, 49271234 - 49271494
Alignment:
| Q |
10 |
atgagaagaagtggttatgaatcaatatttgtctaaatttttcaaaagaacttgctgatggatcatagaaatagaaacaatgtgtaagggaagatataaa |
109 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49271234 |
atgagaagaagtggttatggatcaatatttgtctaaatttttcaaaaggacttgctgatggatcatagaaatagaaacaatgtgtaagggaagatataaa |
49271333 |
T |
|
| Q |
110 |
atacagaaatttgagacagattgtataagcaaaaggtcaaacttcattacacctttgaggataaaaagaaagtggcaaatcttaaaacagagaaaagtac |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49271334 |
atacagaaatttgagacagattgtataaggataaggtcaaacttcattacacctttgaggataaaaagaaagtggcaaatcttaaaacagagaaaagtac |
49271433 |
T |
|
| Q |
210 |
tctgtttgtgtgcaattttgtggcttattatggatccgcaatccttattatgacccatcac |
270 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49271434 |
tccgtttgtgtgcaattttgtggcttattatggatccgcaatccttattatgacccatcac |
49271494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University